Skip to main content

Table 1 Primers used for quantitative real-time PCR

From: PIWIL4 and SUPT5H combine to predict prognosis and immune landscape in intrahepatic cholangiocarcinoma

GeneName Direction Sequences (5′–3′)
h18S Forward AACCCGTTGAACCCCATT
h18S Reverse CCATCCAATCGGTAGTAGCG
PIWIL4 Forward CCAAGACTGGCAGCTATACCA
PIWIL4 Reverse ACCGTCGAATGCTTTTGCTTT
SUPT5H Forward TGATCCCACGCATCGACTAC
SUPT5H Reverse TGGAGGCCGCTTAAACTTCTT