Skip to main content

Table 2 Primers used for gene detection

From: Activating transcription factor 5 (ATF5) promotes tumorigenic capability and activates the Wnt/b-catenin pathway in bladder cancer

Gene Sequence (5′-3′)
ATF5 F: TGGCTCGTAGACTATGGGAAA
R: ATCAACTCGCTCAGTCATCCA
GAPDH F: TGTGGGCATCAATGGATTTGG
R: ACACCATGTATTCCGGGTCAAT
DVL1 F: GAGGGTGCTCACTCGGATG
R: GTGCCTGTCTCGTTGTCCA
NANOG F: TCCCGAGAAAAGATTAGTCAGCA
R: AGTGGGGCACCTGTTTAACTT
SOX2 F: CTCGTGCAGTTCTACTCGTCG
R: AGCTCTCGGTCAGGTCCTTT
ABCG2 F: CAGGTGGAGGCAAATCTTCGT
R: ACCCTGTTAATCCGTTCGTTTT
TCF1 F: CAGAGGAGAGGAACCAAGCTA
R: GCAACTCGGGACATAAAGCC
CCND1 F: GCTGCGAAGTGGAAACCATC
R: CCTCCTTCTGCACACATTTGAA
CD44 F: CTGCCGCTTTGCAGGTGTA
R: CATTGTGGGCAAGGTGCTATT
JUN F: CATTGTGGGCAAGGTGCTATT
R: ACAGAGCGAGTGAAAATGTGTAT