Skip to main content

Table 2 Primer sequences for qRT-PCR

From: Ferroptosis-related gene signature predicts the prognosis of papillary thyroid carcinoma

Primer Sequence (5′-3′)
ANGPTL7-F TAGAGATGGAGGACTGGGAGG
ANGPTL7-R GTGCACACTTGTCCAAGCAG
CDKN2A-F GGGAGCAGCATGGAGCCG
CDKN2A-R CTGGATCGGCCTCCGACCGTA
DPP4-F AGTGGCGTGTTCAAGTGT
DPP4-R AGTGGCTCATGTGGGTAT
DRD4-F GGGAAGGACAGTGCTTGGATCTG
DRD4-R AGTGCTCTAGATAAGTTGGCAAATGCA
ISCU-F CCAGGTGGATGAAAAGGGGAA
ISCU-R GCAGAGTTCCTTGGCGATGT
Srxn1-F CCCACTGGACCAACTTCTGT
Srxn1-R GTGGCTAGCTCAGACCAAGG
TXNRD1-F AAATTCTTAGGACGGTCGGG
TXNRD1-R AGTCTGCCCTCCTGATAAGC
TFRC-F TCAGTTTCCACCATCTCG
TFRC-R AAGTCTCCAGCACTCCAA
TF-F TCAGCAGAGACCACCGAAGACT
TF-R GACCACACTTGCCCGCTATGTA
PGD-F GTTCCAAGACACCGATGGCAAAC
PGD-R CACCGAGCAAAGACAGCTTCTC
GAPDH-F GTCTCCTCTGACTTCAACAGCG
GAPDH-R ACCACCCTGTTGCTGTAGCCAA