Skip to main content

Table 1 The sequences of gene primers

From: VEGF-B targeting by aryl hydrocarbon receptor mediates the migration and invasion of choriocarcinoma stem-like cells

Gene Primer Sequence (5'-3')
AhR Forward ACGTCAGCAAGTTCACATGG
  Reverse GTGGCAGCACCCTTTCTATC
VEGF-B Forward GAAGACCCAAACCTCTGCAT
  Reverse GCCTGGACAGTGACAAACAG
GAPDH Forward GCTGGCGCTGAGTACGTCGT
  Reverse TGGGTGTCGCTGTTGAAGTC
  1. AhR aryl hydrocarbon receptor