Skip to main content

Table 3 Summary of primer pairs for PCR

From: Co-cultivation of murine BMDCs with 67NR mouse mammary carcinoma cells give rise to highly drug resistant cells

Name Annealing temperature Mean product size Primer Sequence (5' to 3')
Ccr7 61°C 208 bp forward AGCACCATGGACCCAGGGA
    reverse CTGCCTCTCATGTATTCTGT
Cxcr4 57°C 390 bp forward GGCTGTAGAGCGAGTATTGC
    reverse GTAGAGGTTGGTGACAGTGTAGAT
Cxcl12 61°C 512 bp forward ACACTCCGCCATAGCATATGGT
    reverse TGAAGCATGCGTTTGGAGG
EGFP 61.5°C 220 bp forward GACAAGCAGAAGAACGGCATCAAG
    reverse CGGCGGCGGTCACGAACT
HYG 60.5°C 500 bp forward AGCTGCGCCGATGGTTTCTACAA
    reverse ATCGCCTCGCTCCAGTCAATG
Syn A 60°C 281 bp forward TACCTGATGCGCCTGGAGCT
    reverse AAGCTTTGCAGGAACTGGAGAA
Syn B 60°C 201 bp forward CCACCACCCATACGTTCAAA
    reverse GGTTATAGCAGGTGCCGAAG
Slc1a5 59°C 585 bp forward CTGGATTATGTGGTACGCCAC
    reverse GACCTGTCCACTAGCCAGTC
Dhfr 59°C 159 bp forward CCACAACCTCTTCAGTGGAAGGTAAACAGA
    reverse TTGGCAAGAAAATGAGCTCCTCGTGG
Gapdh 68°C 980 bp forward TGAAGGTCGGTGTGAACGGATTTGGC
    reverse CATGTAGGCCATGAGGTCCACCAC