Skip to main content

Table 1 Human SRD5A1 specific and mismatch (mm) siRNAs.

From: 5-alpha-reductase type I (SRD5A1) is up-regulated in non-small cell lung cancer but does not impact proliferation, cell cycle distribution or apoptosis

Abbreviation Target Name Sequence
siRNA 1 SRD5A1 NM_001047.1_STEALTH_406 CCACTACGGGCATCGGTGCTTAATT
mm 1 Mismatch NM_001047.1_STEALTH_CTL_406 CCAGGCATACGTGGCTTCGATCATT
siRNA 2 SRD5A1 NM_001047.1_STEALTH_ 542 GCAGTGTATGCTGATGACTGGGTAA
mm 2 Mismatch NM_001047.1_STEALTH_ CTL_542 GCATATGGTCGAGTAGGTCGTCTAA
siRNA 3 SRD5A1 NM_001047.1_STEALTH_701 GAATACGTAACTGCAGCCAACTATT
mm 3 Mismatch NM_001047.1_STEALTH_ CTL_701 GAAATGCGTCACGACCAACTATATT
\