Skip to main content

Advertisement

Table 1 Primer sequences used for real-time RT-PCR

From: Changes in the MALT1-A20-NF-κB expression pattern may be related to T cell dysfunction in AML

Primers Sense and Antisense Accession no. Products
A20F 5′-CTGGGACCATGGCACAACTC-3′ NM006290 182 bp
A20R 5′- CGGAAGGTTCCATGGGATTC -3′   
MALT1F 5′-TCTTGGCTGGACAGTTTGTGA-3′ NM_006785.2 230 bp
MALT1R 5′-GCTCTCTGGGATGTCGCAA-3′   
NF-κBF 5′-CCACAAGACAGAAGCTGAAG-3′ NM003998 149 bp
NF-κBR 5′-AGATACTATCTGTAAGTGAACC-3′   
MALT1-V1F 5′-AAGCCCTATTCCTCACTACCAG-3′ NM_006785.2 195 bp
MALT1-V1R 5′ -CACTCCACTGCCTCATCTGTTC-3′   
β2mF 5′- TACACTGAATTCACCCCCAC -3′ J00105 145 bp
β2mR 5′- GCGGCATCTTCAAACCTC -3′