Skip to main content

Advertisement

Table 1 Primers used for real-time PCR amplifications

From: Curcumin inhibits leptin gene expression and secretion in breast cancer cells by estrogen receptors

Primer Primer length Sequence (5′ to 3′) Product size (bp)
Leptin forward 22 CACCAAAACCCTCATCAAGACA 80
Leptin reverse 24 CTTTCTGTTTGGAGGAGACTGACT
ERα forward 20 GCCAGCAGGTGCCCTACTAC 132
ERα reverse 23 TGGTACTGGCCAATCTTTCTCTG
ERβ forward 19 AAGAGCTGCCAGGCCTGCC 268
ERβ reverse 21 GCGCACTGGGGCGGCTGATCA
Β-actin forward 20 TGGACTTCGAGCAAGAGATG 137
Β-actin reverse 20 GAAGGAAGGCTGGAAGAGTG