Skip to main content

Table 1 The oligonucleotides and primers used in this study

From: RETRACTED ARTICLE: miR-484 suppresses proliferation and epithelial–mesenchymal transition by targeting ZEB1 and SMAD2 in cervical cancer cells

Name Sequence (5′–3′)
Pri-miR-484-forward CGACGGATCCAAGCGCACCCTTCACTTC
Pri-miR-484-reverse GCTCGAATTCCGCTTCAAGGTTCCTTTCG
ASO-miR-484 AUCGGGAGGGGACUGAGCCUGA
ASO-NC CAGUACUUUUGUGUAGUACAA
SMAD2-forward GCGGAATTCAACATGTCGTCCATCTTGCCATTC
SMAD2-reverse CCAGCTCGAGTTATGACATGCTTGAGCAACG
ZEB1-forward GCGGATCCGCGGATGGCCCCAGGTGTAAG
ZEB1-reverse GACGCCTCGAGTTAGGCTTCATTTGTCTTTTCTTC
SMAD2-3′UTR-S GATCCTTTCTAGTATCTTACAGCCTGATAAGCTTG
SMAD2-3′UTR-AS AATTCAAGCTTATCAGGCTGTAAGATACTAGAAAG
ZEB1-3′UTR-S GATCCTTCTGGAGAGGTCAGAGTTGACAAGCTTG
ZEB1-3′UTR-AS AATTCAAGCTTGTCAACTCTGACCTCTCCAGAAG
SMAD2-3′UTRmut-S GATCCTTTCTAGTATCTTACCGAGCTATAAGCTTG
SMAD2-3′UTRmut-AS AATTCAAGCTTATAGCTCGGTAAGATACTAGAAAG
ZEB1-3′UTRmut-S GATCCTTCTGGAGAGGTCATCTAACTACAAGCTTG
ZEB1-3′UTRmut-AS AATTCAAGCTTGTAGTTAGATGACCTCTCCAGAAG
miR-484-RT primer GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACATCGGGAG
miR-484-forward TGCAGTCAGGCTCAGTCCCC
U6-RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC
U6-forward TGCGGGTGCTCGCTTCGGCAGC
Reverse primer CCAGTGCAGGGTCCGAGGT
qPCR-actin-forward CGTGACATTAAGGAGAAGCTG
qPCR-actin-reverse CTAGAAGCATTTGCGGTGGAC
qPCR-ZEB1-forward TAAAGTGGCGGTAGATGGTA
qPCR-ZEB1-reverse ACTGTTTGTAGCGACTGGATT
qPCR-FN1-forward CAGTGGGAGACCTCGAGAAG
qPCR-FN1-reverse TCCCTCGGAACATCAGAAAC
qPCR-Snail-forward TTCTCTAGGCCCTGGCTGC
qPCR-Snail-reverse TACTTCTTGACATCTGAGTGGGTCTG
qPCR-Twist-forward GCAAGAAGTCGAGCGAAGAT
qPCR-Twist-reverse GCTCTGCAGCTCCTCGAA