Skip to main content

Table 1 Details of primers used in experiment

From: Depletion of membrane cholesterol compromised caspase-8 imparts in autophagy induction and inhibition of cell migration in cancer cells

mRNAs NCBI gene accession Primers Sequences (5′–3′) Tm Product size (bp)
CASPASE-8 XM_005246891.4 Forward GTTGTGTGGGGTAATGACAATCT 58.92 183
Reverse CCATTCCTGTCCCTAATGCTG 58.42
MAP1LC3A XM_011529085.2  Forward TCCTGAACTGAGCTGCCTCTA 60.27 131
Reverse CACCCAGAGGGACAACCCTA 60.55
BECN-1 NM_001313998.1 Forward GGTTGAGAAAGGCGAGACACG 61.52 133
Reverse TGTCCACTGCTCCTCAGAGT 60.18
RIPK-1 NM_001317061.1 Forward TGGCAGGAAAGAAGGCCC 59.56 144
REVERSE CCTAGGCTGCCCATGGTGTT 62.22
CFLAR XM_017005196.1  Forward GCAGCCTCTTGGAGGTGGAT 61.92 116
Reverse CGCAGTACACAGGCTCCAGA 61.88
ATG-3 M_001278712.1  Forward CGAGTGAAGCAAAGCGAGGA 60.67 128
Reverse GACCGGACCCAGCTGTCA 61.31
Cyclophylin-A M_001300981.1 Forward CTCGAATAAGTTTGACTTGTGTTT 56.17 165
Reverse CTAGGCATGGGAGGGAACA  58.38
PUM-1 NM_014676.2 Forward AGCCCAATAACAACCTGGCA 59.89 144
Reverse CGCCGAGAGAACTGCTACTT 59.83
PIK3C3 XM_011526031.2 Forward CCTGGAAGACCCAATGTTGAAG 59.18 236
Reverse CGGGACCATACACATCCCA 58.78