Skip to main content

Table 1 Primer sequences for amplification of TP53 exons [13]

From: Establishment and characterization of three stable Basal/HER2-positive breast cancer cell lines derived from Chinese breast carcinoma with identical missense mutations in the DNA-binding domain of TP53

Target Forward primer (5′→3′) Reverse primer (5′→3′) Product (bp) Codon position
Exon 1 GTCGGCGAGAATCCTGACT CCAACAATGCAACTCCTATGAT 481 0
Exon 2 TCAGACACTGGCATGGTGTT GGGGACAGCATCAAATCATC 498 1–25
Exon 3 TCAGACACTGGCATGGTGTT GGGGACAGCATCAAATCATC 498 25–32
Exon 4 GGGACTGACTTTCTGCTCTTGT GCCAAAGGGTGAAGAGGAATC 543 33–125
Exon 5 GTTTCTTTGCTGCCGTCTTC TTCCTTCCACTCGGATAAGATG 387 126–187
Exon 6 TACAAGCAGTCACAGCACATGA GGTCAAATAAGCAGCAGGTTAAGA 370 187–224
Exon 7 GTGAAACCCCGTCTCTACTGAA GAGGAGAAGCCACAGGTTAAGA 588 225–261
Exon 8 GGAGTAGATGGAGCCTGGTTTT GTTGGGCAGTGCTAGGAAAG 328 261–307
Exon 9 GGTAAGCAAGCAGGACAAGAAG TACAACCAGGAGCCATTGTCTT 313 307–331
Exon 10 CATGTTGCTTTTGTACCGTCAT TGGATACACTGAGGCAAGAATG 408 332–367
Exon 11 AACATATTTGCATGGGGTGTG CCAGTCTCCAGCCTTTGTTC 1580 367–394