Skip to main content

Table 2 Primer sequences for qRT-PCR

From: MicroRNA-218-5p inhibits cell growth and metastasis in cervical cancer via LYN/NF-κB signaling pathway

Gene Primer sequence
β-actin F: 5′- AGCGAGCATCCCCCAAAGTT -3′
R: 5′- GGGCACGAAGGCTCATCATT -3′
LYN F: 5′- TGTGAGAGATCCAACGTCCA -3′
R: 5′- AAACTGCCCTTGGCCATGTA -3′
MiR-218-5p F: 5′- CGAGTGCATTTGTGCTTGATCTA -3′
R: 5′- TAATGGTCGAACGCCTAACGTC -3′
U6 F: 5′- CTCGCTTCGGCAGCACA -3′
R: 5′- AACGCTTCACGAATTTGCGT -3′
si-LYN Sense: 5′- GCAUGGAGAAUGGUGGAAA -3′
Antisense: 5′- UUUCCACCAUUCUCCAUGC -3′
si-LYN control Sense: 5′- GCAAGAGUAGGGUGUGAAA -3′
Antisense: 5′- UUUCACACCCUACUCUUGC -3′
MiR-218-5p mimics 5′- UUGUGCUUGAUCUAACCAUGU -3′
MiR-218-5p mimics control 5′- UCACAACCUCCUAGAAAGAGUAGA -3′
MiR-218-5p inhibitor 5′- AACACGAACUAGAUUGGUACA -3′
MiR-218-5p inhibitor control 5′- UUGUACUACACAAAAGUACUG -3′