Skip to main content

Table 1 The primers sequences for genes used in the study

From: WP1130 reveals USP24 as a novel target in T-cell acute lymphoblastic leukemia

Name Sequence (5′–3′)
USP9X
 F AGGTGGTGGAATGCTTAT
 R GAGGTCTGGTGGTGATAG
USP24
 F TGAGATGCCAGTTATTAGA
 R AGTTATCCAGCCAAGTAA
Actin
 F CATCCTCACCCTGAAGTACC
 R AGCCTGGATAGCAACGTACAT