Skip to main content

Table 1 The specific primer sets for HPV used for polymerase chain reaction (PCR) amplification

From: Co-prevalence of human Papillomaviruses (HPV) and Epstein–Barr virus (EBV) in healthy blood donors from diverse nationalities in Qatar

HPV type Forward primer (5′-3′) Reverse primer (5′-3′) Ta (°C)
E6/E7 region
 16 ATGCATGGAGATACACCTACATTGCAT GTTTCTGAGAACAGATGGGGCACAC 61
 18 GCTTTGAGGATCCAACACGG TGCAGCACGAATGGCACTGG 61
 31 GGGCTCATTTGGAATCGTGTG AACCATTGCATCCCGTCCCC 61
 33 TGAGGATGAAGGCTTGGACC TGACACATAAACGAACTGTG 61
 35 CTATTGACGGTCCAGCT TACACACAGACGTAGTGTCG 61
 45 CCCACGCGAACCACAG TCTAAGGTCCTCTGCCGAGC 46.3
 51 TACGTGTTACAGAATTGAAG AACCAGGCTTAGTTCGCCCATT 46.3
 52 GCAGAACAAGCCACAAGCAA TAGAGTACGAAGGTCCGTCG 60
 58 CGAGGATGAAATAGGCTTGG ACACAAACGAACCGTGGTGC 40.5
L1 region
 GP5/GP6 TTTGTTACTGTGGTAGATACTAC GAAAAATAAACTGTAAATCATATT 50.5
 6 TGTCCCATCTGCGCACCGAAGAC CGTACACTGTTTGTGGGCGCTTC 42.5
 11 AGTTCCGTAGATGCCAAGGGCA TGCCTCAGGTGAGGCCCAATGC 42.5
 26 TGGTATACAACGAGTGTCAGCTCC GGGGCAATGATGGCCATGTCG 40.5
 39 TGTGCAGTACCAGTGACGGATCG ATTTTTGGCGTTGTGACTCTGTG 40.5
 53 TTGTTCAGTGTACGGGGCTAGC GTGACGCCATTGCAGTTATCGCCT 43.3
 56 CTGGGCACTAGGTCAAAGCCTGCT CAACCACGCGTAAAAGCACTCAT 53.8
 59 AGACACCGTTACATGAGCTGCT TCATTCTCGGAGTCGGAGTCAG 43.3
 66 TGCGGTAGTATCCTTGGGCAGTG TACAATAAGGGCCACACGCCAA 46.3
 68 GTCAAAAAGACGCCCCTGCACCTA CACACCTTAGGGTAGGGCTACAA 48.8
 73 GGGGTGGGCAAAGGTAGGTAGC ACAATCCAGGGGCCTCTGGTCCGA 48.8
 82 TGTCCGTGGACACCTGCGACCA GTAGTTAAAGGTGATGTGGCAACC 48.8