Skip to main content

Table 2 Primers for qRT-PCRRNAs

From: Circular RNA circ-CSPP1 regulates CCNE2 to facilitate hepatocellular carcinoma cell growth via sponging miR-577

  Forward sequence 5′–3′ Reverse sequence 5′–3′
Circ-CSPP1 AGCAACAGAGGAACAAGAG GAGAAGGAACAGGATGAACT
CSPP1 AGCAACAGAGGAACAAGAG CTACCCTCATGAGGGGGTGC
miR-577 GGACUUUCUUCAUUCACACCG GACCACUGAGGUUAGAGCCA
U6 CGCTTCGGCAGCACATAT AAATATGGAACGCTTCACGA
GAPDH CGGAGTCAACGGATTTGGTCGTAT AGCCTTCTCCATGGTGGTGAAGAC