Skip to main content

Table 2 The primers used for qRT-PCR

From: LncRNA LINC00261 overexpression suppresses the growth and metastasis of lung cancer via regulating miR-1269a/FOXO1 axis

Gene name The forward primer (5′–3′) The reversed primer (5′–3′)
LINC00261 GTCAGAAGGAAAGGCCGTGA TGAGCCGAGATGAACAGGTG
FOXO1 TCGTCATAATCTGTCCCTACACA CGGCTTCGGCTCTTAGCAAA
GAPDH GCTCTCTGCTCCTCCTGTTC ACGACCAAATCCGTTGACTC
miR-1269a GACTGAGCCGTGCTACTGG TGTCGTGGAGTCGGCAATTG
U6 snRNA CGCAAGGATGACACGCAAAT CGGCAATTGCACTGGATACG