Skip to main content

Table 1 Primer sequences used for RT-qPCR

From: Activation of the LINC00242/miR-141/FOXC1 axis underpins the development of gastric cancer

TargetPrimer sequences (5′–3′)
LINC00242F: TTCAGGCGCTGTCTGTTCTT
R: TGCGAATCGATGGGGATCAG
FOXC1F: ACTCGGTGCGGGAGATGTT
R: CCTTGATGGGTTCCTTTAGC
miR-141F: ACACTCCAGCTGGGCATCTTCCAG
R: CTCAACTGGTGTCGTGGAGTCGGC
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
GAPDHF: TGAAGGTCGGAGTCAACGG
R: CTGGAAGATGGTGATGGGATT
  1. F forward, R reverse