Skip to main content

Table 1 Oligonucleotides used in this study

From: Promoter methylation, transcription, and retrotransposition of LINE-1 in colorectal adenomas and adenocarcinomas

Gene Sequence (5′ To 3′) Product (bp) Application
LINE-1 expression primers (GenBank accession number L19088) (25) F: TGAGAACGGGCAGACAGACT
R: AGGTCTGTTGGAATACCCTGCC
129 RT-qPCR
LINE-1 AQAMA Primers F: GGGTTTATTTTATTAGGGAGTGTTAGA
R: TCACCCCTTTCTTTAACTCAAA
148 qPCR
LINE-1 AQAMA methylation specific probe FAM-TGCGCGAGTCGAAGT-BHQ1 qPCR
LINE-1 AQAMA unmethylation specific probe HEX-TGTGTGAGTTGAAGTAGGG-BHQ1 qPCR