Skip to main content

Table 1 Sequences used for qRT-PCR and siRNA assays

From: circRAE1 promotes colorectal cancer cell migration and invasion by modulating miR-338-3p/TYRO3 axis

Names Sequences (5′— 3′)
circRAE1 Forward AGAGAGGGGCCTGATTGTCTA
  Reverse AGTGTGCATCTGCTGATGTTTC
E-cadherin Forward GCTGGACCGAGAGAGTTTCC
Reverse CAAAATCCAAGCCCGTGGTG
Vimentin Forward GGACCAGCTAACCAACGACA
Reverse AAGGTCAAGACGTGCCAGAG
Linear RAE1 Forward AGGCAGTACTTCTCCAGGTTCA
Reverse GGCAAGGTTGGTGGGCTAAA
TYRO3 FORWARD AGTTGGCTGTGGACCCTGGAG
REVERSE AGGATGTGCGGCTGTGAGGAG
GAPDH Forward ATGGGGAAGGTGAAGGTCG
Reverse TTACTCCTTGGAGGCCATGTG
miR-338-3p Forward CGCGTCCAGCATCAGTGATT
Reverse AGTGCAGGGTCCGAGGTATT
RT Primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAACAA
U6 Forward CTCGCTTCGGCAGCACATATACT
Reverse ACGCTTCACGAATTTGCGTGTC
RT Primer AAAATATGGAACGCTTCACGAATTTG
si-circRAE1-Homo1 Sense GGAUCAAAGCUCCAAACUACA
Antisense UAGUUUGGAGCUUUGAUCCAA
si-circRAE1-Homo2 Sense GCAGUGCAACUACAGACAAUC
Antisense UUGUCUGUAGUUGCACUGCCA
si-circRAE1-Homo3 Sense GGACCUCAGCAGUAACCAAGC
Antisense UUGGUUACUGCUGAGGUCCCA
si-TYRO3 Sense GGUGGAGAGGAACUACGAAGA
  Antisense UUCGUAGUUCCUCUCCACCAG
Negtive control Sense AUGGAAUUUUGUUGUGAAAUC
Antisense UUCACAACUUAAUUCCAAGAU