Skip to main content

Table 1 Primers for real‐time PCR

From: Evaluation of the potential role of long non-coding RNA LINC00961 in luminal breast cancer: a case–control and systems biology study

Genes Forward (5′-3′) Reverse (5′-3′)
β2M AGATGAGTATGCCTGCCGTG GCGGCATCTTCAAACCTCCA
LINC00961 (SPAAR) GGGAATCTGTGCTCACGTCTT TGGCCCCACTGCTGAAATC
  1. β2M Beta-2-microglobulin, PCR polymerase chain reaction