Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Histone methyltransferase SUV39H2 regulates LSD1-dependent CDH1 expression and promotes epithelial mesenchymal transition of osteosarcoma

Gene Forward sequence (5′–3′) Reverse sequence (5′–3′)
SUV39H2 CCCAAGCTTATGGAATATTATCTTGT CGGGATCCGTTGAGGTAACCTCTGC
LSD1 GAAACTGGAATAGCAGAGAC GGTGGACAAAGCACAGTATCA
CDH1 CTACGTGTCT CTATCTGCAA AAGATCATCCT GTCCCTACTC
GAPDH CCACTCCTCCACCTTTGAC ACCCTGTTGCTGTAGCCA
  1. RT-qPCR, reverse transcription quantitative polymerase chain reaction; SUV39H2, Suppressor of variegation 3–9 homolog 2; LSD1, Lysine-specific demethylase 1; CDH1, E-cadherin gene; GAPDH, reduced glyceraldehyde-phosphate dehydrogenase