Skip to main content

Table 2 Primers used in this study

From: Ninjurin 2 rs118050317 gene polymorphism and endometrial cancer risk

SNPs 2nd-PCRP 1st-PCRP UEP_SEQ
rs118050317 ACGTTGGATGGTGTAGTGATTGACACCTG ACGTTGGATGACAGGAGCTGGTCATGTTGC ggggtGCCGATGGGGAAGGATTAG
rs75750647 ACGTTGGATGTGTTCGCTGTGTACTGGATG ACGTTGGATGCCCCCACAAAATTACAAACC CTAAAGCAGGGTGGAG
rs7307242 ACGTTGGATGAAATGCTTCTCCTGGAAGTC ACGTTGGATGGCCCTAGCCTGTTTCTTTAG CCAGATCACTAGCTCTGA
rs10849390 ACGTTGGATGTCACACAATCTCACAGGGAC ACGTTGGATGGAAATCAGTACTGCCTGTGC tcgccCAGGGACAGCCCGCTGCC
rs11610368 ACGTTGGATGTCTGTGACTCCTTGCCAATG ACGTTGGATGCTCTGCAATGTTACACAGCC CCTTGCCAATGGATAGAATAGAA
  1. UEP SEQ unextended mini-sequencing primer