Skip to main content

Table 2 All primer sequences in this study

From: LINC00963 affects the development of colorectal cancer via MiR-532-3p/HMGA2 axis

ID Forward sequence(5′-3′) Reverse sequence(5′-3′)
LINC00963 GCCAAGGAGGGAGTTGTGGCTGC CTGTTGCCACACCATGCACCACTCC
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
miR-532-3p GGCTTGCAGTCGTATCCAGT GTATCCAGTGCGTGTCGTGG
HMGA2 ACCCAGGGGAAGACCCAAA CCTCTTGGCCGTTTTTCTCCA
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
DDOST GAGACTCATTCGCTTTTCTTCCG CTCCAAAATCTTCTACCGAAGGG
MBD1 AAGTCTTTCGCAAGTCAGGGG TCAGCTCAACTTTGCTTCGGA
PISD AGGACCTGCATCACTACCG CCGATGGGCTAATCACGCTG
TARS GGAGAAGCCGATTGGTGCT TCAACTCAGCTCGACCTCCAT