Skip to main content

Table 1 Primer sequences

From: Transcription elongation factor A-like 7, regulated by miR-758-3p inhibits the progression of melanoma through decreasing the expression levels of c-Myc and AKT1

Gene Forward (5ʹ-3ʹ) Reverse (5ʹ-3ʹ)
Homo-TCEAL7 GAGCTGACGTGAACCGAAGT GGAGGAAGGAGCTATCTGTGG
AKT1 GAAGACGGGAGCAGGCG TGTACTCCCCTCGTTTGTGC
AKT2 CTGCCACCATGAATGAGGTGAA CATGGTCACTTTAGCCCGTG
STAT3 CTGTGGGAAGAATCACGCCT ACATCCTGAAGGTGCTGCTC
β-catenin CTGAGGAGCAGCTTCAGTCC GGCCATGTCCAACTCCATCA
TGF-β GGGCTACCATGCCAACTTCT GACACAGAGATCCGCAGTCC
YAP CCCTCGTTTTGCCATGAACC GTTGCTGCTGGTTGGAGTTG
c-Myc GCAATGCGTTGCTGGGTTAT CGCATCCTTGTCCTGTGAGT
FOXO1 TTGAACCCACACGGTGGTAG CCTCGGCCTCTGAAACACTT
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
Mus-TCEAL7 AGGGCTCTGCATTCTAACCG TCACTGCTTTCCTAACGCGA
AKT1 CCGCCTGATCAAGTTCTCCT CAGACCCATGAGCCCACATT
AKT2 GTGGCTGGAAAAGGCGGTAT TTCACACGCTGTCACCTAGC
c-Myc GTTGGAAACCCCGCAGACAG GTAGCGACCGCAACATAGGA
GAPDH AGAGAGGCCCAGCTACTCG CAAATCCGTTCACACCGACC
miR-758 ACACTCCAGCTGGGAACGATG CTCAACTGGTGTCGTGGAGTCGGCA
U6 CTCGCTTCGGCAGCACA AACGCT TCACGAATTTGCGT