Skip to main content

Table 3 RT-PCR primers

From: Deciphering molecular mechanisms underlying chemoresistance in relapsed AML patients: towards precision medicine overcoming drug resistance

Gene Forward primer sequence Reverse primer sequence Refs. Refseq accession
ENT1 GGGCAGCCTGTTTGGTCT CCACTGGCAATAGCGCAG [96] NM_001078177.2
ENT2 CTCCTGTCCATGGCCAGTG GGGCCTGGGATGATTTATTG [96] NM_001300868.1
ENT3 TCAGCGGTGCCTCCACTGT GCAGCCAAGTCCACCAATGA [96] NM_018344.6
CNT3 ACATTTCTTTTGGGGTTCCAT GCAATCAGATTCACAGCGATG [96] NM_001199633.2
dCK GCCGCCACAAGACTAAGGAA GACTTCCCTGCAGCGATGTT [42] NM_000788.3
CDA TGTGCTGAACGGACCGCTA GCAGGTCCTCAGGCCCAA [42] NM_001785
NDK ATTCCGCCTTGTTGGTCTGA TTGGAGTCTGCAGGGTTGGT Current NM_198175
PN-I AACAACATAGCATCCCCGTGT TTCCTCAAGGCACCATCATGT Current NM_001002010.5
BCRP GGATGAGCCTACAACTGGCTT CTTCCTGAGGCCAATAAGGTG [97] NM_004827.3
MRP1 GTGTTTCTGGTCAGCCCAACT TTGGATCTCAGGATGGCTAGG [97] NM_004996
P-gp CCGACTTACAGATGATGTCTCCAA CAGACAGCAGCTGACAGTCCAA Current NM_000927
BCL2 GTCATGTGTGTGGAGAGCGTCA GGCAGGCATGTTGACTTCACTT Current NM_000633
BCLX(L) TCTTCCGGGATGGGGTAAAC AAGCGTTCCTGGCCCTTTC Current NM_138578
MCL1 GGACAAAACGGGACTGGCTAG TGGCTAGGTTGCTAGGGTGC Current NM_021960
CTSD TGCTCAAGAACTACATGGACGC CGAAGACGACTGTGAAGCACT [98] NM_001909
ATP6V1H AGCCCTGAAGAGAAGCAAGAGA CGATTCAACATTGGCAGAAAGT [98] NM_015941
MSMO1 AGCATCCTTGGCTGTGGAATAT CCCATGTCTCTGGCTTATCCTT Current NM_006745
HMGCR GGGAAAATATTGCTCGTGGAAT CAAGGACACACAAGCTGGGAA Current NM_000859.3
CAD GGTCTCTGCAAGTGGTTTGAA CCTGTTCCCGCAACTTCTT [96] NM_004341
CTPS CCCCAGATCTGGTTGTATGCA AAGCGATCATATCTGTCAGCCA Current NM_001905
UMPS GGATTATGGAACTAAGCGTCTTGT CACACTGAGTGGAGGCGGAT Current NM_000373
GART GTGGAGGAAGGGAACATACGC TCTCTTTGCAGAATTGAGCAAGG [99] NM_000819
TS TCCCGAGACTTTTTGGACAGC TGATGGTGTCAATCACTCTTTGC [99] NM_001071
DHFR ATGCCTTAAAACTTACTGAACAACCA TGGGTGATTCATGGCTTCCT [99] NM_000791
RFC ACCATCATCACTTTCATTGTCTC ATGGACAGGATCAGGAAGTACA [99] NM_194255
FPGS GAGAGGCCGAGCGGTGG TGCCTGTGGATGACACCTCTG Current NM_004957
GUSB CCATTCCTATGCCATCGTG ATGTCGGCCTCGAAGGG [96] NM_000181