Skip to main content

Table 1 Primer sequence

From: M2 macrophages‐derived exosomal microRNA-501-3p promotes the progression of lung cancer via targeting WD repeat domain 82

Gene Primer sequence (5′–3′)
miR-501-3p Forward: GCCGAGAATGCACCCGGGCA
Reverse: CTCAACTGGTGTCGTGGA
WDR82 Forward: CTCCATCGTGCTCTATGACT
Reverse: GATGAGGTCCACACCATATT
U6 Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCGT
β-actin Forward: CAGCACAATGAAGATCAAGA
Reverse: GATCCACATCTGCTGGAAG
  1. miR-501-3p microRNA-501-3p, WDR82 WD repeat domain 82