Skip to main content

Table 1 Primer list

From: Modulation of LXR signaling altered the dynamic activity of human colon adenocarcinoma cancer stem cells in vitro

Gene Forward primer Reverse primer Tm (°C)
ABCA1 TTCCCGCATTATCTGGAAAGC CAAGGTCCATTTCTTGGCTGT 57.9
ABCG8 AGCCTCCTTGCTAGATGTGAT GTCTCTCGCACAGTCAAGTTG 57.9
ABCG5 ACTGCTTCTCCTACGTCCTG CTGTAGTTGCCAATCAGTCGG 59.4
SCD1 TCTAGCTCCTATACCACCACCA TCGTCTCCAACTTATCTCCTCC 60.3
FASN AAGGACCTGTCTAGGTTTGATGC TGGCTTCATAGGTGACTTCCA 60.6
GSK3β CCGACTAACACCACTGGAAGCT AGGATGGTAGCCAGAGGTGGAT 59.8
PFKFB3 ATTGCGGTTTTCGATGCCAC GCCACAACTGTAGGGTCGT 58.8
HIF1A-F ATCCATGTGACCATGAGGAAATG TCGGCTAGTTAGGGTACACTTC 60.3
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG 59.8