Skip to main content

Table 1 Primer sequence

From: Silenced lncRNA DDX11-AS1 or up-regulated microRNA-34a-3p inhibits malignant phenotypes of hepatocellular carcinoma cells via suppression of TRAF5

Genes Primers (5′→3′)
miR-34a-3p Forward: CGGGATCCGCAGCCTCTCCATCTTC
  Reverse: GGAATTCGGCTAGGAGGATCAACACAC
U6 Forward: CGCAAGGATGACACGCAAATTCG
  Reverse: CAGTGCAGGGTCCGAGGT
DDX11-AS1 Forward: CTGGCTACTCTTCCTCCTGG
  Reverse: CAGAGGACATGTGGGAGGTT
TRAF5 Forward: CCTACGGAAAGACCTGAAAGAGC
  Reverse: GGGTATTCAGGACACAAGTTTTCC
Ki67 Forward: GAGGAGAAACGCCAACCAAGAG
  Reverse: TTTGTCCTCGGTGGCGTTATCC
Caspase-3 Forward: GGAGTCTGACTGGAAAGCCGAA
  Reverse: CTTCTGGCAAGCCATCTCCTCA
GAPDH Forward: TGCACCACCAACTGCTTAGC
  Reverse: GGCATGGACTGTGGTCATGAG
  1. MiR-34a-3p, MicroRNA-34a-3p; DDX11-AS1, DDX11 antisense RNA 1; TRAF5, tumor necrosis factor receptor-associated factor 5; GAPDH, glyceraldehyde-3-phosphate dehydrogenase
\