Skip to main content

Table 3 Sequences of the forward and reverse primers

From: MSCs loaded with oncolytic reovirus: migration and in vivo virus delivery potential for evaluating anti-cancer effect in tumor-bearing C57BL/6 mice

Gene, Premier Sequence
P53 Forward CCGAAGACTGGATGACTGC
  Reverse GTCTCGGTGACAGGGTCC
BAX Forward CAGCGGCAGTGATGGAC
Reverse TCCTGGATGAAACCCTGTAG
Bcl-xL Forward CAGTCAGCCAGAACCTTATC
Reverse AACACCTGCTCACTTACTGG
HPRT1 Forward TCCCAGCGTCGTGATTAG
Reverse CGAGCAAGTCTTTCAGTCC
Reovirus (L3 gene) Forward CGCGTCCTCAATTTTGGGTAAAC
Reverse CCGCCGTCTTTTGGATATGAACTA
Beclin 1 Forward ACAGCCCAGGCGAAACCAG
Reverse CCTCCCCGATCAGAGTGAAGC
mLC3 Forward CGCCGACCGCTGTAAGGAG
Reverse GCGCCGGATGATCTTGACC