Skip to main content

Table 1 DLG2 NCBI reference sequence and PCR primer target sequence

From: The loss of DLG2 isoform 7/8, but not isoform 2, is critical in advanced staged neuroblastoma

NCBI reference sequence Isoform Protein Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
NM_001142699.1 Isoform 1, 7 and 8 PSD93β (975aa) GCACGGAGCAAGAAGGGAT AGCTTATTCCAAGCTTTGCT
NM_001364.3 Isoform 2 PSD93α (870aa) GCTCTCACTCAGTGCCTTCA GTCCGGAGTGCACAGTAACA
NM_001142700.2 Isoform 3 PSD93 (749aa) TTTGAGTGTTACCAGCTTTCGCT TTTCTGTCCCATTGACCGGA
NM_001142702.2 Isoform 4 PSD93 (334aa) TCAGGTTCCGCTAGTGAGTT AACCGTCGTCACCTAATCCG
NM_001351274.2
NM_001351275.2
Isoform 7
Isoform 8
PSD93ζ (969aa/968aa) AGAAGACAGATACTGACCGAGC CACGGAGCAAGAAGGGATGT
\