Skip to main content

Table 1 Sequences of primers for the PCR analysis

From: Recognize the role of CD146/MCAM in the osteosarcoma progression: an in vitro study

Gene Primer 5′–3′ Fragment (bp)
CD146 F: AGTCCTGAGCACCCTGAATGTCC 263
  R: CAATCACAGCCACGATGACCAC  
GAPDH F: CCTCTGACTTCAACAGCGACAC 174
  R: TGGTCCAGGGGTCTTACTCC