Skip to main content

Table 2 Hub transcription factors primer sequence

From: Prognostic signature composed of transcription factors accurately predicts the prognosis of gastric cancer patients

Gene ID Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
ZNF300 GAGTAACCTTCACAACTCCCAG ATGCCTCAGTCACTGTTTTGC
ELK3 GAGAGTGCA ATCACGCTGTG GTTCGAGGTCCAGCAGATCAA
SP6 CAGCCTCTCCAAACTTACCAG AGGTCCTCGCAGGTTACCC
MEF2B ATGGACCGTGTGCTGCTGAAGT TCCGAAACTTCTCTCCTGGCTC
ACTB CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT