Skip to main content

Table 1 Sequences of 2 shRNAs of LINC00115

From: LINC00115 promotes stemness and inhibits apoptosis of ovarian cancer stem cells by upregulating SOX9 and inhibiting the Wnt/β-catenin pathway through competitively binding to microRNA-30a

  shRNA sequence
Sh1 GAAGAAUGGUACAAAUCCAAG
Sh2 CUUAAAGGAACCAAUGAGUCC