Skip to main content

Table 2 Primer sequence of RT-qPCR

From: LINC00115 promotes stemness and inhibits apoptosis of ovarian cancer stem cells by upregulating SOX9 and inhibiting the Wnt/β-catenin pathway through competitively binding to microRNA-30a

Gene Sequence 5′–3′
CD133 F: AGTCGGAAACTGGCAGATAGC R: AGTCGGAAACTGGCAGATAGC
LINC00115 F: TGGCTTGTCTTCCATCGTCC R: GCACGAGGGTTGTTACAGGA
CD44 F: CGGACACCATGGACAAGTTT R: CCGTCCGAGAGATGCTGTAG
GAPDH F: CAAGATCATCACCAATGCCT R: CCCATCACGCCACAGTTTCC
NANOG F: TTTGTGGGCCTGAAGAAAACT R: AGGGCTGTCCTGAATAAGCAG
POU5F1 F: CTGGGTTGATCCTCGGACCT R: CCATCGGAGTTGCTCTCCA
miR-30a F: GCGACTGTAAACATCCTCGAC R: CAGCTGCAAACATCCGACTG
SOX9 F: AGGAAGTCGGTGAAGAACGG R: AGGAAGTCGGTGAAGAACGG
SOX9-3’UTR-Primer F: CGGACTAGTACAGACCTTAATCTTAATTA R: CCCAAGCTTTTTTTAATGCAATGTATATT
SOX9-mut-Primer F: GACTAGTTATTAACAGTTTTAGAAGTC R: CAAGCTTAATGCAATGTATATTTATTG
Luc-LINC00115wt-Primer F: CGGACTAGTATCAGCAGAGATATGGAGGA R: CCCAAGCTTGACAATCCAGGTCATCCTTC
Luc-LINC00115mut-Primer F: GACTAGTGTAGCAGAGAGGGCAGCAGA R: CAAGCTTTTGATACTTATACTTAGTTG
U6 F: CTCGCTTCGGCAGCACATATACT R: ACGCTTCACGAATTTGCGTGTC
  1. RT-qPCR, reverse transcription quantitative polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; miR-30a, microRNA-30a