Skip to main content

Table 1 The sequences of primers applied for quantitative RT-PCR

From: Lnc-STYK1-2 regulates bladder cancer cell proliferation, migration, and invasion by targeting miR-146b-5p expression and AKT/STAT3/NF-kB signaling

Primers name Sequences (5′-3′)
lnc-STYK1-2-F CCTTGGCACTGTCAAATGGTTC
lnc-STYK1-2-R ACACACCCTCTCCTCACATAGC
Hsa-miR-146b-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGCC
Hsa-miR-146b-5p-F CGGAGCACTTGAGAACTGAAT
Fas-F TGTGTGATGAAGGACATGGC
Fas-R ACATTTGGTGCAAGGGTCAC
NR5A2-F AGAAGCCATGTCTCAGGTGATC
NR5A2-R AAGGCAGCATGGTTCAGAGG
ITGA2-F CCGATGTGTCTATTGGTGCCT
ITGA2-R GGTCTGAACTTTGCACTGAAGC
GAPDH F GAGTCAACGGATTTGGTCGT
GAPDH R GACAAGCTTCCCGTTCTCAG
U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT