Table 2 Primers for PCR of the TP53 gene (Exons 4–9)
From: Establishment and characterization of a novel ovarian high-grade serous carcinoma cell line—IPO43
Exon | Primer | Oligonucleotide sequence |
|---|---|---|
4 | forward | gacctggtcctctgactgct |
4 | reverse | caggcattgaagtctcatgg |
5 | forward | cgtgttccagttgctttatctg |
5 | reverse | gccagacctaagagcaatcagt |
6 | forward | ctcagatagcgatggtgagcag |
6 | reverse | cttaacccctcctcccagagac |
7 | forward | cctcatcttgggcctgtgtta |
7 | reverse | tggaagaaatcggtaagaggtg |
8–9 | forward | ccttactgcctcttgcttctc |
8–9 | reverse | cattttgagtgttagactggaaactt |