Skip to main content

Advertisement

Table 1 PCR primer sequences used in the study

From: Knockdown of WAVE3 impairs HGF induced migration and invasion of prostate cancer cells

Gene Sense (5′-′3) Antisense (5′-′3)
WAVE-3 TACTCTTGCCGCTATCATACG TGCCATCATATTCCACTCCTG
β-actin ATGATATCGCCGCGCTCG CGCTCGGTGAGGATCTTCA
MMP-1 GGATGCTCATTTTGATGAAG TAGAATGGGAGAGTCCAAGA
MMP-2 TTTGATGACGATGAGCTATG TGCAGCTCTCATATTTGTTG
MMP-7 GCTATGCGACTCACCGTGCTGTG AGCGTGTTTCCTGGCCCATCAAATG
MMP-9 AACTACGACCGGGACAAG ATTCACGTCGTCCTTATGC
MMP-11 GTGCCCTCTGAGATCGAC CAGGGTCAAACTTCCAGTAG