Cell culture and experimental reagents
Human pancreatic cancer cells, such as HPAC, Capan-1 (from American Type Culture Collection, Rockville, MD) were cultured in RPMI-1640 (Invitrogen) supplemented with 10 % fetal bovine serum (FBS) and 100 units/mL penicillin and 100 μg/mL streptomycin, in a 5 % CO2 humidified atmosphere at 37 °C. Matrine (50 μg/ml, Qilu Pharmaceutical Co., Ltd.) and docetaxel (0.05 μg/ml, Sigma, USA) were added into the medium when necessary as indicated in figure legends. Primary antibodies of Wnt, β-catenin, MT1-MMP, and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, USA). Other reagents used in this study, such as Anti-mouse-IgG-HRP and Anti-Rabbit-IgG-HRP, were purchased from California Bioscience (California Bioscience, USA), Transwell Invasion Chambers were found from Promega, USA.
MTT assay
MTT [3-(4,5-dimethylthiazolyl-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma- Aldrich; St. Louis, MO) assay was used for evaluation the viability of HPAC or Capan-1 cells upon Matrine treatment. Total 1 × 104 cells/well were grown overnight in 96-well plate. The second day, various concentrations of Matrine were added and incubation for 48 h. MTT solution was added to each well at a final concentration of 500 μg/ml for 4 h. Formazan crystals formed by living cells were then dissolved in DMSO and measured at 570 nm by Multi-Detection microplate reader (Bio-Rad, USA).
Monolayer cell migration assay
A monolayer wound-healing model was performed as cell migration assay. HPAC or Capan-1 cells were seeded in 6-well-plate for 24 h in RPMI-1640 medium. A confluent monolayer of HPAC cells were then scraped with a sterile 200 μl pipette tip and washed with PBS. After incubation with completed RPMI-1640 alone or contained with matrine (50 μg/ml) or with docetaxel (0.05 μg/ml) for 48 h, cell migration images were captured using an inverted phase contrast microscope at 100× magnification.
Transwell invasion assay
Matrigel Invasion Chambers were hydrated for 4 h before starting the invasion assay. Log-phase cells (4 × 104) were plated in 200 μl RPMI-1640 containing 2 % FBS in the upper chamber of the transwell. The lower chamber was filled with 500 μl completed RPMI-1640 containing 10 % FBS. The upper chamber cells were treated with matrine and docetaxel as previous description and allowed to migrate for 10 h at 37 °C and 5 % CO2 circumstance followed by carrying out the invasion assay. The cells were fixed for 15 min at room temperature by replacing the culture medium in the bottom with 4 % formaldehyde dissolved in PBS. Then, the cells on the upper chamber were moved with a cotton swab. After washing the chambers 5 times by dipping the chambers in a large beaker filled with dH2O, the cells that remained on the bottom of the lower chamber were stained with 0.1 % crystal violet. The migrated clones were photographed under an optical microscope. The cell numbers were counted at 12 different areas.
RT–PCR analysis
Total RNA was extracted from HPAC cells using the TRIZOL reagent (Invitrogen Life Technologies). Reverse transcription (RT) was performed with 1 μg of total RNA and 10 μM of specific primers. cDNAs were amplified by polymerase chain reaction (PCR) for testing MT1-MMP (sense 5′-AGCCCCGAAGCCTGGCTACA-3′; antisense 5′-GCCGCCCTCACCATCGAAGG-3′,492-bp product) and Glyceral dehyde-3-phosphate dehydrogenase (GAPDH) (sense 5′-ACCACAGTCCAT GCCATCAC-3′; antisense 5′-TCCACCACCCTGTTGCTGTA-3′, 556-bp product), which was used as loading controls.
Enzyme-linked immunosorbent assay
HPAC cells were treated as described above. Concentrations of MMP-9 and MMP-2 in the cell culture supernatants were quantified using MMP-9 and MMP-2 ELISA kits (R&D Systems, USA). Each sample was analysed in triplicate and manipulated according to the kit’s protocols.
Western blot analysis
HPAC cells were lysed in RIPA buffer [50 mM Tris (pH 7.4), 150 mM NaCl, 1 % Triton X-100, 0.1 % SDS, 1 % sodium deoxycholate, 5 mM EDTA, 100 mM NaF, and 1 mM Na3VO4] containing a protease inhibitor cocktail for 30 min on ice, followed by centrifuged for 30 min at 16000 g. Protein concentrations were determined by the BCA method (Pierce, USA). Equal total proteins were electrophoresis by 12 % SDS-PAGE gel and transferred to PVDF membranes using a wet transblot system (Bio-Rad, Hercules, CA). The membranes were blocked for 1 h at room temperature with 5 % nonfat dry milk and incubated overnight at 4 °C with antibodies against Wnt, β-catenin, Axin, GSK-3β, MT1-MMP and β-actin (1:1000). After washing three times, membrane was incubated for 1 h with HRP-conjugated goat anti-rabbit secondary antibody diluted 1:5,000 in PBST. After further washing and processed using Super Signal West Pico chemiluminescent substrate (Pierce, USA), the membrane was exposed to Fujifilm LAS3000 Imager (Fuji, Japan). The band densities were normalized relative to the relevant β-actin with Image J Analyst software (NIH).
Chromatine immuno-precipitation (CHIP) assay
CHIP assay was performed using the CHIP Kit (Sigma, USA) with slight modifications. HPAC cells (2 × 107) were cross-linked with 1 % formaldehyde for 10 min at room temperature, followed by the addition of 1 ml of 125 mM glycine to inactivate the formaldehyde. Cells were washed twice with ice-cold PBS and then scraped and centrifuged at 1000 g at 4 °C for 5 min. Pelleted cells were lysed with 1 ml modified-RIPA lysis buffer (0.1 % SDS, 10 mM EDTA, 1 % Triton Χ-100 and 50 mM Tris–HCl pH 8.0) containing with protease inhibitor cocktail and incubated on ice for 10 min. After sonication to produce genomic DNA to lengths of 0.2 to 0.5 kb (optimized at 10 ~ 15-s pulses), samples were centrifuged at 13,000 g for 10 min to remove insoluble cell debris. Lysates were diluted in ChIP dilution buffer (0.01 % SDS, 0.1 % Triton X-100, 2 mM EDTA, 20 mM Tris–HCl pH 8.0 and 500 mM NaCl). Chromatin solution was precleared with 20 μl of 3 % BSA/protein A agarose for 2 h at 4 °C with rotation. Anti–β-catenin polyclonal (Santa Cruz Biotechnologies) antibody was added to the precleared supernatant and incubated overnight at 4 °C with rotation. Negative controls included a sample incubated without antibody and one incubated with rabbit IgG (Santa Cruz Biotechnologies) to determine whether interactions were due to nonspecific IgG interactions. Bead complexes were washed first with low-salt immune complex wash buffer, followed by high-salt immune complex wash buffer and a final LiCl immune complex wash buffer for 5 min each on a rotating platform followed by brief centrifugation. After the final wash, DNA was extracted by incubating the beads for 15 min with 200 μl elution buffer (1 % SDS and 50 mM NaHCO3). Samples were then uncrosslinked in a 65 °C water bath overnight, and DNA was purified using Qiagen Nucleotide Removal Kit (Qiagen, Valencia, CA). Polymerase chain reaction (PCR) primers used to amplify the MT1-MMP promoter region were as follows: GTCTCCCGCCCCAAGACCCT (forward) and GGAACACCACATCGGGGGCG (reverse).
Statistical analysis
All experiments were performed three times and the results were expressed as mean ± SD. Statistical analysis was performed by SPSS11.0. T test was used in order to compare the average values between two populations of data. A P value of less than 0.05 was considered to indicate statistical significance.
