Table 5 Predicted complementary sequence of the candidate targets and miR-146a-5p
Terms | The predicted binding sites |
|---|---|
miR-146a-5p | 3′ UUGGGUACCUUAAGUCAAGAGU |
Position 1955-1961 of PRKCE 3′ UTR | 5′…CUAAUGAUGACAUUCAGUUCUCU… |
Position 2501-2508 of PRKCE 3′ UTR | 5′…GCCUCUGGCUGGUGAAGUUCUCA… |
Position 821-827 of FYN 3′ UTR | 5′…AACUUACUGCGAUUUGUUCUCAA… |
Position 1131-1137 of FYN 3′ UTR | 5′…UUCUAUAUGUCCAGGAGUUCUCC… |
Position 959-965 of AQP1 3′ UTR | 5′…UCUUGCUCAUUCUUCAGUUCUCU… |
Position 2566-2572 of PRKACB 3′ UTR | 5′…UAUGAUCUCAGCCUCAGUUCUCU… |
Position 2040-2047 of ADCY2 3′ UTR | 5′…CUGGGUGGUCCACCAAGUUCUCA… |
Position 666-672 of ADCY5 3′ UTR | 5′…AAAUAAAACAAAACAAGUUCUCC… |
Position 1994-2000 of ADCY5 3′ UTR | 5′…UUUCUUCCAGCUGUUGUUCUCAA… |