Skip to main content
Download PDF

Protective potential of miR-146a-5p and its underlying molecular mechanism in diverse cancers: a comprehensive meta-analysis and bioinformatics analysis

Cancer Cell International volume 19, Article number: 167 (2019) Cite this article

Abstract

Background/aims

Studies have shown that miR-146a-5p was differentially expressed in diverse cancers, but the associations between miR-146a-5p expression and prognosis across multiple types of cancer as well its potential targets and downstream pathways have not been comprehensively analyzed. In this study, we performed the first meta-analysis of the prognostic value of miR-146a-5p expression in diverse malignancies and explored prospective targets of miR-146a-5p and related signaling pathways.

Methods

A thorough search for articles related to miR-146a-5p was performed, and RNA-seq data from The Cancer Genome Atlas (TCGA) and microarray data from gene expression omnibus profiles were used to collect information about the prognostic value of miR-146a-5p. A comprehensive meta-analysis was conducted. Twelve platforms in miRWalk 2.0 were applied to predict targets of miR-146a-5p. TCGA RNA-seq data were used to validate the inverse relationships between miR-146a-5p and its likely targets. Subsequently, gene ontology and pathway analyses were conducted using Funrich version 3.1.3. Potential protein–protein interaction (PPI) networks were constructed. Potential target genes of miR-146a-5p in lung cancer were validated by RT-qPCR.

Results

We included 10 articles in the meta-analysis. In a pooled analysis, the high miR-146a-5p expression group showed a better overall survival in solid cancers, particularly in reproductive system cancers and digestive system cancers. A total of 120 predicted target genes were included in a bioinformatics analysis. Five pathways involving phospholipase C (PLC) and aquaporins (AQPs) were the most significantly enriched Kyoto Encyclopedia of Genes and Genomes pathways. Moreover, the PPI network displayed the related signaling pathways and interactions among proteins. AQP1 and FYN were validated by RT-qPCR to be potential targets of miR-146a-5p in lung cancer.

Conclusion

There is a close link between high miR-146a-5p expression and better overall survival in 21 types of solid cancer, especially in reproductive system and digestive system cancers. Furthermore, miR-146a-5p could inhibit diverse malignancies by modulating pathways linked to PLC or AQPs. In summary, miR-146a-5p is a potential prognostic biomarker and therapeutic target for various cancers.

Background

Cancer is a serious threat to human health, with almost 1,735,350 newly diagnosed cancer cases and nearly 609,640 cancer-related deaths in the United States in 2018 [1, 2]. Gene sequencing technologies are frequently utilized to explore correlations between genomic changes and morbidity from various cancers [2,3,4]. Multiple factors regulate tumorigenesis and tumor development by altering DNA replication, transcription, and translation. The discovery of these factors, including microRNAs (miRNAs) and long non-coding RNAs, was considered a breakthrough for the early diagnosis and prevention of cancers. The identification of new molecular biomarkers and studies of their underlying mechanisms are valuable for the development of more effective treatment strategies.

miRNAs are single-stranded non-coding RNAs (18–22 nucleotides) with vital roles in the regulation of biological processes, including transcription, translation, cell cycle, and organismal development [5]. These molecules are linked to post-transcriptional regulation by interacting with corresponding messenger RNAs (mRNAs). Deregulated expression by miRNAs could increase the risk of metabolic diseases, such as diabetes and obesity, by disrupting signaling pathways [6]. Moreover, numerous studies have reported associations between altered miRNAs and cancers in different systems, suggesting that miRNAs are potential biomarkers for early diagnosis, treatment, and prognosis in cancers [7,8,9,10,11,12,13,14]. Furthermore, miRNAs are promising therapeutic candidates for metastatic cancer [5].

MiR-146a-5p, a member of the microRNA-146 family, has a crucial role in a series of cancer-related processes, including tumorigenesis, tumor progression, and outcomes. The expression of miR-146a-5p is increased in tissue samples from breast cancer and thyroid carcinoma [15, 16]. By contrast, levels of miR-146a-5p are decreased in gastric cancer, lung cancer, and prostate cancer [17,18,19,20]. Decreased miR-146a-5p levels are associated with biological activities in the latter cancers (gastric, lung, and prostate cancers), such as the growth, invasion, and migration of cancer cells [21]. It has been demonstrated that miR-146a-5p is a powerful suppressor in breast cancer, lung cancer, and prostate cancer [18,19,20]. Increasing studies have provided insight into the mechanism underlying the effects of abnormal miR-146a-5p on various cancers. A recent study has shown that down-regulated miR-146a-5p in gastric cancer is associated with poor prognosis and WASF2 might be a target gene of miR-146a-5p [17]. However, more detailed analyses of the correlation between differentially expressed miR-146a-5p and prognosis for other solid tumors are needed. Therefore, we performed a comprehensive and thorough analysis of its prognostic significance by utilizing integrated data extracted from the literature, RNA-seq data from The Cancer Genome Atlas (TCGA) datasets, and the SurvMicro website. Additionally, to examine the mechanism underlying the effects of aberrant miR-146a-5p in solid cancers, a pathway analysis and protein interaction network analysis were conducted.

Materials and methods

Literature search strategy

A systematic searched for literature related to the prognostic value of miR-146a-5p in cancer was performed using the PubMed, EBSCO, CNKI, VIP, and WanFang databases. The most recent search was performed on July 16, 2017. The search terms for English-language databases included “miR146”, “miRNA146”, “microRNA146”, “microRNA146a”, “miR146a”, “miRNA146a”, “microRNA-146a-5p”, “miRNA-146a-5p”, and “miR-146a-5p” as well as “cancer”, “carcinoma”, “adenocarcinoma”, “sarcoma”, “tumor”, “neoplas*”, and “malignan*”, using “OR” to connect terms. Finally, “AND” was used to link the two classes of terms. For searches against Chinese databases, similar terms were input. Two authors performed the search independently to ensure the accuracy.

Eligibility criteria

Only studies that satisfied the following criteria were included in the meta-analysis: (1) samples were obtained from human tissues or blood; (2) clearly described analysis of miR-146a-5p; (3) explored the prognostic value of miR-146a-5p expression levels in cancers; (4) provided sufficient information to extract hazard ratios (HRs) and 95% confidence intervals (CIs). The exclusion criteria were as follows: (1) unrelated to humans; (2) neither Chinese nor English, reviews, conference abstracts, case reports; (3) unable to extract HR and 95% CIs; (4) not satisfying the inclusion criteria.

Data extraction

Data extraction was performed by two reviewers independently. The following information was extracted: the name of the first author, country, publication year, tumor type, number of cases, tumor stage, lymph node metastasis, time of follow-up, sample type, miR-146a level, cut-off values, HR and corresponding 95% CI. Comprehensive discussions were conducted to resolve any disagreements.

Prognostic data for 21 human cancers downloaded from RNA-seq data

Expression levels of miR-146a-5p and corresponding prognostic data were obtained for 21 types of solid cancers from RNA-seq data. Expression values of less than 1 were removed. The median expression values were calculated using SPSS 22.0. Then, each cohort was separated into an experimental group (high expression level) and control group (low expression level). GraphPad Prism 7.0 was utilized to draw survival curves for 21 solid cancers. Cox regression was employed to calculate HRs.

Statistical analysis

Stata12.0 and SPSS 22.0 were used to conduct statistical analyses. HRs and 95% CIs were extracted from the literature, RNA-seq data, and microarray profiles to obtain pooled results. HRs were directly collected if the they were reported in studies. HRs and 95% CIs were calculated based on the methods described by Tierney when the information provided was insufficient. Otherwise, Engauge Digitizer version 4.1 was used for studies that did not report concrete data. This software could determine HRs and 95% CIs based on Kaplan–Meier survival curves. The prognostic data downloaded from TCGA and SurvMicro were analyzed using SPSS 22.0 to estimate HRs and 95% CI. An HR greater than 1 indicated that patients with high miR-146a-5p expression were more likely to have a poor prognosis.

An integrated meta-analysis of relevant literature studies, RNA-seq data, and microarray profiles as well as separate meta-analysis for literature studies and RNA-seq data were performed. Heterogeneity was evaluated by the I2 statistic. Subgroup analysis stratified by human systems was used to identify the source of heterogeneity. Depending on the heterogeneity results, two distinct models were adopted, a random-effects model or fixed-effects model. A random-effects model was applied when there was obvious statistical heterogeneity; a fixed-effects model was applied in other cases. A significant difference was observed when the two-sided p-value was less than 0.05.

Target prediction and validation for miR-146a-5p

Target genes for miR-146a-5p were predicted using MirWalk2.0. Twelve algorithms were used, including miRWalk, Microt4, miRanda, mirBridge, miRDB, miRMap, miRNAMap, Pictar2, PITA, RNA22, RNAhybrid, and TargetScan [22, 23]. According to the miRWalk2.0 algorithm, genes would be recognized as potential targets if there was a seed sequence that binds to miRNAs. The sequence of the genes could be complementary to that of miRNAs in the 3′-untranslated region, 5′-untranslated region, promoter, or coding sequence [22, 23]. To improve the accuracy of the prediction analysis, genes that overlapped in more than seven databases were chosen. Another criterion was applied to select the potential targets based on expression levels. A list of differentially expressed genes (DE genes) for 21 types of solid cancer was obtained from the TCGA and GTEx databases using GEPIA (|Log2FC| > 2, q-value < 0.05, limma methods) [24]. Because miR-146a-5p targets might show differential expression in diverse tumors, the intersection of predicted genes and DE genes in solid cancers contained the most likely potential targets of miR-146a-5p.

To further validate the relationships between miR-146a-5p and the potential targets, the correlations between their expression levels were assessed using R with miRNA sequence data [log2 (RPM + 1), miRNA mature strand expression] and RNA sequence data [log2 (TPM + 0.001), gene expression RNAseq] for the TCGA Pan-Cancer cohort with 7965 tumor samples and 639 non-tumor adjacent-tumor samples. To obtain reliable results, these data were first processed as follows: Relative expression = Expression in the cancer tissue group—mean expression in the non-cancer tissue group. Ultimately, the genes were selected as candidate targets when their expression levels were inversely associated with levels of miR-146a-5p (correlation coefficient < 0, p < 0.05), and these genes were used to explore the mechanism underlying the effects of miR-146a-5p in diverse cancers.

Bioinformatics analysis

The molecular mechanism underlying the effect of aberrant miR-146a-5p levels in solid cancers was evaluated using Funrich version 3.1.3, with the assistance of gene ontology (GO) and pathway analyses. By observing the p-value for each term, significant pathways were identified and the molecular functions, biological processes, and cellular components involved in the effects of miR-146a-5p were explored. The search tool for the retrieval of interacting genes/proteins (STRING) database (http://string-db.org/) was used for the construction of the protein–protein interaction (PPI) network, which displayed potential signaling pathways and connections among proteins in a dimensional way. The potential binding sites of miR-146a-5p and candidate targets were determined using miRWalk2.0. Additionally, scatter diagrams were constructed to visualize correlations between the expression levels of miR-146a-5p and candidate targets in diverse malignant tumors, utilizing miRNA and RNA sequence data.

Validation of potential targets of miR-146a-5p through RT-qPCR

Previously, we found that miR-146a-5p showed a decreased expression in lung cancer tissues compared to normal lung tissues [25]. Then we collected 55 lung cancer tissues (32 lung adenocarcinoma and 23 lung squamous cell carcinoma) and their matched non-tumor lung tissues to further test the expression of miR-146a-5p potential targets (AQP1 and FYN). The mean age of the patients was 56.9 years old. The Ethical Committees of First Affiliated Hospital, Guangxi Medical University, China have approved the study protocol. And all of the patients have signed the informed consent. According to the methods described in our previous studies [26,27,28,29,30,31,32], we isolated total RNA and performed relative quantification analysis. RT–qPCR was executed using the 7900HT PCR system of USA (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA). The internal control in the analysis was GAPDH, with the forward primer (5′-TGCACCACCAACTGCTTA-3′) and the reverse primer (5′-GGATGCAGGGATGATGTTC-3′). The thermocycling steps included hot start at 95 °C for 10 min, 95 °C for 10 s, 60 °C for 5 s and annealing at 72 °C for 5 s, totally 40 PCR cycles. And the 2−∆Cq method was utilized to calculate expression of candidate miR-146a-5p targets.

Results

Characteristics of the studies included in the meta-analysis

A total of 9907 references were collected in the initial search, of which 9722 were removed based on titles and abstracts. After full-text screening, we included ten studies published between 2010 and 2017 in the meta-analysis, with 783 patients in total (Fig. 1) [25, 33,34,35,36,37,38,39,40,41]. Tumor tissues were mostly utilized to detect miR-146a-5p expression, and bone marrow samples were employed in one of the included studies. The necessary information about the ten studies is outlined in Table 1.

Fig. 1
figure 1

Flow diagram of the process for searching for articles

Full size image
Table 1 Main characteristics of the articles included in the meta-analysis
Full size table

Survival curves

The expression and survival data for miR-146a-5p in 21 types of solid cancers were extracted from RNA-seq data, including data for 8519 patients. HRs were estimated using SPSS 22.0 and the results are summarized in Table 2. Kaplan–Meier survival curves were utilized to compare survival between low and high miR-146a-5p expression groups using GraphPad Prism 7.0 (Fig. 2).

Table 2 Characteristics of eligible studies from RNA-seq data and microarray profiles
Full size table
Fig. 2
figure 2

Kaplan–Meier survival curves for miR-146a-5p in diverse cancers using RNA-seq data

Full size image

Pooled meta-analysis results

A comprehensive meta-analysis of relevant studies, RNA-seq data, and microarray expression profiles was conducted to analyze the prognostic value of miR-146a-5p in solid cancers. The results obtained using the total data (HR 0.875, 95% CI 0.784–0.976, I2 = 64.40%) suggested that the high miR-146a-5p group had a better overall survival than that of the low expression group (Fig. 3). Since significant heterogeneity was observed, we used the random-effects model. We obtained similar pooled results in subgroup analyses stratified by human systems (Table 3). Moreover, we found that increased miR-146a-5p levels were closely related to a better overall survival in reproductive system cancers (HR 0.791, 95% CI 0.661–0.947, I2 = 0.00%) and digestive system cancers (HR 0.844, 95% CI 0.738–0.965, I2 = 49.00%) (Table 3). Additionally, an association between high expression miR-146a-5p and a better prognosis was observed in gastric cancer (HR 0.535, 95% CI 0.327–0.877, I2 = 64.40%, random-effects model) (Table 3, Fig. 4).

Fig. 3
figure 3

Subgroup analysis of total records to determine the prognostic value of miR-146a-5p in solid cancers. Generally, miR-146a-5p was expressed at low levels in diverse solid cancers and was related to a worse prognosis for patients with cancer (HR 0.875, 95% CI 0.784–0.976). Due to obvious heterogeneity (I2 = 64.4%), a random-effects model was used, as indicated in the note shown at the bottom

Full size image
Table 3 Summary of meta-analysis results for overall survival
Full size table
Fig. 4
figure 4

Subgroup analysis by tumor type to show the prognostic value of miR-146a-5p in diverse tumors. In the subgroup analysis, decreased miR-146a-5p expression in gastric cancer (GC) was associated with shorter overall survival (HR 0.535, 95% CI 0.327–0.877). The random-effects model was applied as noted above (I2 = 64.40%)

Full size image

The pooled results for the 10 articles identified in the literature search showed no statistical significance, with obvious heterogeneity (HR 0.667, 95% CI 0.438–1.016, I2 = 85.70%) (Table 3). Thus, we used the random-effects model. However, a subgroup analysis by human system indicated that high expression of miR-146a-5p was associated with better prognosis in digestive system cancers (HR 0.355, 95% CI 0.143–0.881, I2 = 66.1%, random-effects model).

The aggregated results for RNA-seq data indicated that high miR-146a-5p expression was associated with a better prognosis in solid cancers without considerable heterogeneity (HR 0.880, 95% CI 0.810–0.956, I2 = 21.60%) (Table 3, Fig. 5). The association between high miR-146a-5p expression and improved survival was found in reproductive system cancers (HR 0.784, 95% CI 0.650–0.946, I2 = 0.00%) and respiratory system cancers (HR 0.780, 95% CI 0.636–0.957, I2 = 0.00%) (Fig. 5). There was no obvious link between miR-146a-5p and prognosis in other cancer types or systems.

Fig. 5
figure 5

Subgroup analysis of TCGA data by human system. In combination with Table 3, lower miR-146a-5p expression was associated with poorer prognosis for patients with reproductive system cancers (HR 0.791, 95% CI 0.661–0.947, I2 = 0.00%) and digestive system cancers (HR 0.844, 95% CI 0.738–0.965, I2 = 49.00%). The final heterogeneity could be considered slight (I2 = 21.6%); Thus, a fixed-effect model was used

Full size image

Target genes of miR-146a-5p

A total of 14,280 genes were identified as candidate targets using 12 prediction platforms, and only those targets identified by more than seven platforms were included in subsequent analyses. A total of 926 target genes were obtained, of which 429 were abnormally expressed in solid cancers (Fig. 6). Finally, expression levels of 120 genes were confirmed to be inversely correlated with the level of miR-146a-5p and thus these genes were identified as potential targets for subsequent analyses (Fig. 7).

Fig. 6
figure 6

The 429 potential targets of miR-146a-5p. The genes were selected as potential targets based on sequence complementation and their expression levels in solid cancers

Full size image
Fig. 7
figure 7

Flow chart of miR-146a-5p target prediction and validation. By utilizing twelve prediction platforms, DE genes from the GEPIA website and miRNA and RNA sequencing data for the TCGA Pan-Cancer cohort were used to identify 120 likely targets of miR-146a-5p

Full size image

Bioinformatics analysis

Funrich version 3.1.3 was utilized to perform GO and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses using the 120 potential targets. In total, 126 biological functions were obtained in the GO analysis, of which 25 were significant (p < 0.05). Several processes might function as essential activities regulated by miR-146a-5p in various malignancies, including Transport, Signal transduction, and Cell communication in the biological processes category; Transcriptional repressor complex and Plasma membrane in the cellular components category; and adenylate cyclase activity, transcription factor activity, histone binding, and protein-tyrosine kinase activity in the molecular functions category (Fig. 8). A total of 291 critical pathways were identified by KEGG, and pathways involving phospholipase C (PLC) and aquaporins (AQPs) were the most statistically significant (p < 0.001), as shown in Table 4 and Fig. 8. In particular, PRKACB, PRKCE, ADCY5, ADCY2, and AQP1 were identified as five key genes in the above pathways (Fig. 9). A protein network was constructed using STRING with 120 predicted targets, as shown in Fig. 10. The genes that frequently interacted with other genes were recognized as hub genes of miR-146a-5p, including PRKACB, FYN, and PRKCE. Overall, PRKACB, PRKCE, ADCY5, ADCY2, AQP1, and FYN were recognized as the most likely targets of miR-146a-5p. The predicted binding sites for the six genes and miR-146a-5p are displayed in Table 5. There were significant correlations between levels of the six likely targets and miR-146a-5p in solid cancers, as shown in Fig. 11.

Fig. 8
figure 8

Visualization of the most highly enriched pathways and GO processes for miR-146a-5p targets. As described in Table 4, 120 potential targets were evaluated. miR-146a-5p was potentially involved in the regulation of following activities in various cancers: a KEGG pathways: PLC-mediated cascade, DAG and IP3 signaling, AQP-mediated transport, EGFR interactions with PLC-γ, and PLC-γ1 signaling; b biological processes: transport, signal transduction, cell communication; c cellular components: plasma membrane; d molecular function: transcription factor activity and protein-tyrosine kinase activity

Full size image
Table 4 Most highly enriched pathways and processes for miR-146a-5p sorted by p-values
Full size table
Fig. 9
figure 9

Connections among potential targets of miR-146a-5p in crucial pathways. a Pathways of PLC (green nodes); b pathways of AQPs (green nodes). PRKACB, PRKCE, ADCY5, ADCY2, and AQP1 are five potentially vital genes (red nodes) in the above pathways

Full size image
Fig. 10
figure 10

PPI network of miR-146a-5p potential target genes drawn using STRING. The most frequent genes were identified as hub genes, including PRKACB, FYN, and PRKCE

Full size image
Table 5 Predicted complementary sequence of the candidate targets and miR-146a-5p
Full size table
Fig. 11
figure 11

Correlations between expression levels of candidate targets and miR-146a-5p in pan-cancer. Expression data for miR-146a-5p and the six selected targets were obtained from the TCGA Pan-Cancer cohort, as above described. Expression levels of all candidate targets were inversely associated with miR-146a-5p expression. GraphPad Prism 6.0 was employed to generate scatter plots. a PRKCE; b FYN; c AQP1; d PRKACB; e ADCY2; f ADCY5. g AQP1 expression in lung cancer. h FYN expression in lung cancer

Full size image

AQP1 and FYN were validated by RT-qPCR to be potential targets of miR-146-5p

It has been previously proven by us that miR-146a-5p was down-regulated in lung cancer tissues [25]. Currently, we found that two likely miR-146a-5p targets, AQP1 and FYN, showed higher levels in tissues obtained from lung cancer, compared to noncancerous lung tissues (Fig. 11). The primers of AQP1 were GGACACCTCCTGGCTATTGACTAC (the forward primer) and GTTGCTGAAGTTGTGTGTGATCAC (the reverse primer); the primers of FYN were CTCAGCACTACCCCAGCTTC (the forward primer) and ATCTCCTTCCGAGCTGTTCA (the reverse primer). Hence, the expression of AQP1 and FYN tend to be inversely modulated by miR-146a-5p in lung cancer.

Discussion

Using an integrated meta-analysis, we found that lower miR-146a-5p expression was correlated with worse outcomes in solid cancers, especially in reproductive system cancers and digestive system cancers. In particular, we observed that low expression of miR-146a-5p in gastric cancer is significantly associated with poor prognosis. Additionally, five critical pathways [PLC-mediated cascade, diacylglycerol (DAG) and inositol 1,4,5-triphosphate (IP3) signaling, AQP-mediated transport, epidermal growth factor receptor (EGFR) interaction with PLC-γ, and PLC-γ1 signaling] and several GO processes were identified as potential mechanisms underlying the effects of miR-146a-5p in cancers. Moreover, we identified six potential targets of miR-146a-5p, including PRKCE, FYN, AQP1, PRKACB, ADCY2, and ADCY5. Specifically, we have verified the expression of AQP1 and FYN in lung cancer. The high expression of AQP1 and FYN in lung cancer tissues increased the possibility of them as true targets of miR-146a-5p.

Cancer is one of the most common causes of death in humans, and rapid invasiveness and metastasis lead to an unfavorable prognosis. More than half of recent deaths in the United States are caused by lung cancer, breast cancer, prostate cancer, colorectal cancer, or pancreatic cancer in both males and females, and this can be attributed to the inability to detect tumor growth, limitations of modern imaging technologies, and insufficient bio-markers [2]. Extensive research has indicated that quite a few molecules (long non-coding RNAs, miRNAs, circRNAs, and genes) participate in the modulation of biological activities in cancers, providing a basis for improving detection and treatment [42, 43]. Therefore, we explored the clinical significance and underlying mechanisms of miR-146a-5p in diverse cancers, a miRNA with an indispensable role in the regulation of tumor progression. Our pooled results suggested that miR-146a-5p functions as a protective factor or tumor suppressor in solid cancers.

Notably, significant pooled results were found for reproductive system cancers and digestive system cancers, indicating that miR-146a-5p has prognostic value in these cancers. Several studies have demonstrated that miR-146a-5p could function as an inhibitory factor in reproductive system cancers. Sun et al. found that miR-146a-5p levels are decreased in prostate cancer, leading to tumor progression and poor prognosis; miR-146a-5p might be useful for the treatment for prostate cancer as a suppressor [20]. Additionally, miR-146a-5p has been reported to function as a powerful inhibitor in cervical cancer [44]. Similar results have been obtained for epithelial ovarian cancer [45, 46]. In this work, we found that elevated miR-146a-5p expression was indeed correlated with a better prognosis for patients with reproductive system cancers. We speculated that miR-146a-5p might be a protective factor in reproductive system cancers and is a novel therapeutic target for the improved management of tumor development. Future research is needed to evaluate this hypothesis.

Additionally, a series of studies have shown that miR-146a-5p has an indispensable role in retarding tumor progression and prolonging overall survival for patients with cancers of the digestive system. In gastric cancer, growing evidence has revealed the anti-tumor function of miR-146a-5p; it functions as a protective factor to repress neoplasm metastasis and tissue infiltration and to improve overall survival [47, 48]. Recent studies have revealed that miR-146a-5p expression is lower in pancreatic cancer tissues than in non-tumor tissues based on analyses of miR-146a-5p levels in human tissue samples, cell lines, and mouse models by real-time PCR [49, 50]. Our previous studies have confirmed that miR-146a-5p could clearly inhibit the deterioration of hepatocellular carcinoma [51, 52]. A similar protective role of miR-146a-5p has been suggested in other digestive system cancers, including colorectal cancer [53] and esophageal squamous cell carcinoma [54,55,56]. The results of our study were consistent with the notion that higher miR-146a-5p expression is linked to a favorable prognosis in the above cancers, especially gastric cancer. The results of our study could provide support for further research on the clinical application of miR-146a-5p in digestive system cancers.

Increased miR-146a-5p expression is beneficial for repressing the development of other cancers, especially non-small cell lung cancer (NSCLC). A recent meta-analysis concluded that the outcome of NSCLC was better in the experimental group with high levels of miR-146a-5p than in a group with low levels of expression, and indicated the potential prognostic role of miR-146a-5p [57]. Our previous work also showed that the loss of miR-146a-5p might lead to the deterioration of NSCLC with a shorter progression-free survival [25]. In head and neck squamous cell carcinoma (HNSCC) and breast cancer, miR-146a-5p was identified as a tumor suppressor [34, 58, 59]. However, we only observed a trend in which the over-expression of miR-146a-5p was related to longer survival times in NSCLC, breast cancer, and HNSCC. These associations should be explored in further studies.

We next explored the functions of predicted targets, validated predicted targets, analyzed KEGG pathways and GO enrichment, and constructed a PPI network. We found that miR-146a-5p might play a prominent role in modulating a series of biological pathways closely associated with PLC, a key enzyme on cytomembranes, including the PLC-mediated cascade, DAG and IP3 signaling, EGFR interactions with PLC-γ, and PLC-γ1 signaling. DAG and IP3 are important for the generation of phosphatidylinositol 4,5-bisphosphate and the regulation of PLC, which are linked to the release of calcium and activation of protein kinase C (PKC), two vital second messengers in signal transduction [60, 61]. Prior studies have noted the importance of PLC in modulating proliferation, invasion, and metastasis, suggesting its role in carcinogenesis and tumor progression in various malignancies [62, 63]. It has been reported that abnormal expression levels or mutations in PLC-γ (a PLC member) are related to the occurrence of breast cancer, gastric cancer, and oral squamous cell carcinoma [64,65,66,67]. We found potential interactions between EGFR and PLC-γ activities, which have a role in breast cancer, whereby EGFR/human epidermal growth factor receptor 2/PLC-γ1 signaling results in tumor cell invasion and migration [25, 68, 69]. Additionally, we found that miR-146a-5p clearly participates in the regulation of signal transduction on plasma membranes and protein-tyrosine kinase activity. We hypothesized that the specific binding sites of miR-146a-5p are located on the plasma membrane, and miR-146a-5p has a protective role, potentially by repressing the invasion and migration of tumor cells via the regulation of the above processes in solid cancers.

We found that miR-146a-5p could modulate two pathways involving AQP (regulation of water balance by renal AQPs and AQP-mediated transport). AQPs are a group of specific proteins related to the transport of water and glycerol across cell membranes; they act as promoters in cell proliferation and cell motility [70, 71]. AQPs play an indispensable role in maintaining water homeostasis in the kidney and are closely related to the regulation of urine osmolality [72]. It has been suggested that the abnormal regulation of renal AQPs would lead to diseases correlated with water balance disorders in the kidney, such as diabetes insipidus and hyponatremia [73]. Moreover, as mentioned in literature reviews, AQP expression is closely associated with tumor angiogenesis and dissemination in the majority of human malignancies [74, 75]. The application of AQP inhibitors might be beneficial to improve prognosis in diverse cancers [76]. Overall, these findings suggest that miR-146a-5p could be used to treat water balance disorders in the kidney and diverse cancers via the regulation of AQP-associated pathways.

PRKCE and AQP1 were identified as two likely targets of miR-146a-5p involved in the pathways of PLC and AQPs, respectively. We also found that FYN is a potential hub gene in the miR-146a-5p PPI network. PRKCE, also known as PKC ε, is a novel member of the PKC isozyme family involved in the regulation of complex cellular processes in diverse cancers, as a paramount bridge between protein networks [77]. PKC ε is widely considered an oncogene, with increased expression in diverse malignant tumors, including lung cancer [78, 79], breast cancer [80], prostate cancer [81], clear cell renal carcinoma [81, 82], and HNSCC [83]. Associations have been detected between up-regulated PKC ε levels and metastatic outcomes in general cancers [84, 85]. Zhang et al. elucidated the negative modulation by miR-146a-5p f PKC ε expression, as a tumor suppressor in papillary thyroid carcinoma; PKC ε was identified as a direct target of miR-146a-5p based on a dual luciferase assay [86]. Inverse correlations between miRNAs and PKC ε were also revealed in lung cancer and HNSCC [79, 83]. Moreover, PKC ε inhibitors have been prospectively applied as novel therapies for patients with cancers [80]. In our study, PRKCE was identified as a potential target for miR-146a-5p; higher miR-146a-5p expression might decrease PRKCE levels to repress cellular activities in solid cancers, but further studies are needed to confirm this.

FYN, a member of Src family tyrosine kinases, is a proto-oncogene responsible for regulating the expression of protein-tyrosine kinases on membranes [87]. FYN is closely related to cancer development, tumor progression, and even dissemination in diverse cancers. Early in 2010, Yoshihito and colleagues revealed that FYN is highly expressed in prostate cancer and possibly leads to a more advanced tumor stage [88]. Elias et al. confirmed the intensive effects of FYN in promoting breast cancer development, suggesting that the over-expression of FYN is related to worse outcomes [89]. Researchers have also revealed a prospective strategy to better manage breast cancer by targeting FYN. Additionally, several studies have demonstrated that FYN functions as a promoter in diverse cancers and is associated with a poor prognosis [90,91,92]. In this study, we discovered higher expression levels of FYN in lung cancer than in normal tissues by conducting RT-qPCR for clinical tissues. Consequently, we speculated that miR-146a-5p might suppress the malignant transformation of cancers by controlling protein-tyrosine kinases activity, targeting FYN.

AQP1, a member of the AQP family, could modulate water transport across the plasma membrane and thereby is related to water balance in the kidney [73, 93]. Previous studies have revealed the positive regulation of AQP1 in tumor progression and demonstrated that AQP1 suppressors could repress biological activities of various tumors, including the growth of tumor cells, cell motility, and angiogenesis [94, 95]. Positive correlations between AQP1 expression and tumor development have been detected in cancers of the reproductive system (ovarian cancer [96] and prostate cancer [97]), digestive system (cancers of the stomach [98], colon [99], and esophagus [100]), and other systems (astrocytoma [101], and cancers of the lung [102], breast [103, 104], bladder [105], and pleura [106]). In our study, the high expression of AQP1 in lung cancer was proved by RT-qPCR, contrasting with low miR-146a-5p levels in lung cancer tissues in previous work [25], which strengthened the reliability of our prediction results and implied that AQP1 might be a target of miR-146a-5p in diverse cancers, especially lung cancer. Thus, it is possible that miR-146a-5p is an effective target for the management of tumor progression via AQP1, as a novel anti-cancer therapy.

As for PRKACB, ADCY2, and ADCY5. PRKACB encodes the catalytic subunit β of protein kinase A, a type of protein mainly depending on cyclic AMP (cAMP) [107]. Current studies have found the likely tumorigenic roles of PRKACB in diverse malignant tumors, including gastrointestinal cancer (gastric, colon and pancreatic tumors) and others (breast, ovary, leukemia and brain tumors) [107,108,109]. Moreover, PRKACB might be a promising target in cancer treatment by increasing drugs responsiveness to tumors [108, 109]. Adenylate cyclase 2 (ADCY2), a gene related to the production of cAMP, is greatly implied in acceleration of phosphor-acidification and metabolic processes of glycogen [110, 111]. Duerr et al. found that ADCY2 expression was obviously elevated in pancreatic neuroendocrine malignant tumors, possibly linked with tumor invasiveness [112]. Similar to ADCY2, ADCY5 is a catalyzer in the formation of cAMP. Takashi et al. and Chen et al. discovered that abnormal ADCY5 expression was correlated to tumor aggressiveness and DNA Methylation of ADCY5 might lead to unsatisfied outcomes for patients with lung cancer [113, 114]. We assumed that the participation of these genes in human cancers may correlate with miR-146a-5p. More biological investigation should be conducted in future to validate the correlation of three potential miR-146a-5p targets (PRKACB, ADCY2, and ADCY5) and miR-146a-5p in cancers.

However, there are a few limitations that should also be pointed out. Because hematological tumors may have different biological characteristics from solid tumors, the clinical significance and mechanism of miR-146a-5p in hematological tumors and solid tumors may be different. Because of the small number of blood tumors included in this study, the above problems could not be analyzed in detail. More samples need to be added to clarify the problem in future work. Moreover, the biological roles of miR-146a-5p in cancers and the targeting regulatory relationship between miR-146a-5p and target genes needed to be validated through further experiments in future studies. In the present study, we only chose AQP1 and FYN for qRT-PCR validations. RT-qPCR experiments for all potential targets in various cancer types should be performed in future studies to achieve a comprehensive verification.

Conclusion

Based on a comprehensive meta-analysis and bioinformatics analysis, we concluded that miR-146a-5p might serve as an inhibitory factor in general cancers (reproductive system cancers and digestive system cancers, especially gastric cancer). We speculated that miR-146a-5p might inhibit the progression of solid cancers via pathways involving PLC (candidate targets: PRKCE and FYN) or AQPs (candidate target: AQP1) by inversely regulating target genes. Moreover, miR-146a-5p could be used to treat certain diseases correlated with water balance disorders in the kidney by regulating kidney AQP pathways. In addition, miR-146a-5p could repress certain biological activities in tumor cells by the modulation of cell communication on plasma membranes. Overall, miR-146a-5p could be utilized as a prognostic biomarker, with implications for the prediction and treatment of diverse cancers.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Abbreviations

TCGA:

The Cancer Genome Atlas

GEO:

gene expression omnibus

HRs:

extract hazard ratios

95% CIs:

95% confidence intervals

DE genes:

differentially expressed genes

GO:

gene ontology

STRING:

search tool for the retrieval of interacting genes/proteins

PPI:

protein–protein interaction

KEGG:

Kyoto Encyclopedia of Genes and Genomes

PLC:

pathways involving phospholipase C

AQPs:

aquaporins

DAG:

diacylglycerol

EGFR:

epidermal growth factor receptor

PKC:

protein kinase C

HNSCC:

head and neck squamous cell carcinoma

GC:

gastric cancer

TNBC:

triple negative breast cancer

NSCLC:

non-small cell lung cancer

DLBCL:

diffuse large B cell lymphoma

NK/T:

NK/T cell lymphoma

ALL:

acute lymphoblastic leukemia

AML:

acute myeloid leukemia

qRT-PCR:

quantitative real-time polymerase chain reaction

MISH:

miRNA in situ hybridization

BLCA:

urothelial bladder cancer

BRCA:

breast invasive cancer

CESC:

cervical cancer

COAD:

colon adenocarcinoma

ESCA:

esophageal cancer

GBM:

glioblastoma multiforme

HNSC:

head and neck squamous cell carcinoma

KIRC:

kidney renal clear cell carcinoma

KIRP:

kidney renal papillary cell carcinoma

LAML:

acute myeloid leukemia

LGG:

lower grade glioma

LIHC:

liver hepatocellular carcinoma

LUAD:

lung adenocarcinoma

LUSC:

lung squamous cell carcinoma

OV:

ovarian serous cystadenocarcinoma

PAAD:

pancreatic adenocarcinoma

READ:

rectum adenocarcinoma

SARC:

sarcoma

SKCM:

skin cutaneous mMelanoma

STAD:

stomach adenocarcinoma

UCEC:

uterine corpus endometrial carcinoma

References

  1. Mandelker D, Zhang L, Kemel Y, Stadler ZK, Joseph V, Zehir A, Pradhan N, Arnold A, Walsh MF, Li Y, et al. Mutation detection in patients with advanced cancer by universal sequencing of cancer-related genes in tumor and normal dna vs guideline-based germline testing. JAMA. 2017;318(9):825–35.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Siegel RL, Miller KD, Jemal A. Cancer statistics. Cancer J Clin. 2018;68(1):7–30.

    Article  Google Scholar 

  3. Felsenstein M, Hruban RH, Wood LD. New developments in the molecular mechanisms of pancreatic tumorigenesis. Adv Anatom Pathol. 2018;25(2):131–42.

    CAS  Google Scholar 

  4. Mack SC, Northcott PA. Genomic analysis of childhood brain tumors: methods for genome-wide discovery and precision medicine become mainstream. J Clin Oncol. 2017;35(21):2346–54.

    Article  CAS  PubMed  Google Scholar 

  5. Jafri MA, Al-Qahtani MH, Shay JW. Role of miRNAs in human cancer metastasis: implications for therapeutic intervention. Semin Cancer Biol. 2017;44:117–31.

    Article  CAS  PubMed  Google Scholar 

  6. Del Carmen Martinez-Jimenez V, Mendez-Mancilla A, Patricia Portales-Perez D. miRNAs in nutrition, obesity, and cancer: the biology of miRNAs in metabolic disorders and its relationship with cancer development. Mol Nutr Food Res. 2018;62(1):1600994.

    Article  CAS  Google Scholar 

  7. Sun JJ, Chen GY, Xie ZT. MicroRNA-361-5p inhibits cancer cell growth by targeting CXCR7 in hepatocellular carcinoma. Cell Physiol Biochem. 2016;38(2):777–85.

    Article  CAS  PubMed  Google Scholar 

  8. Shi W, Bruce J, Lee M, Yue S, Rowe M, Pintilie M, Kogo R, Bissey PA, Fyles A, Yip KW, et al. MiR-449a promotes breast cancer progression by targeting CRIP2. Oncotarget. 2016;7(14):18906–18.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Wu Z, Liu K, Wang Y, Xu Z, Meng J, Gu S. Upregulation of microRNA-96 and its oncogenic functions by targeting CDKN1A in bladder cancer. Cancer Cell Int. 2015;15:107.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  10. Mizuno K, Seki N, Mataki H, Matsushita R, Kamikawaji K, Kumamoto T, Takagi K, Goto Y, Nishikawa R, Kato M, et al. Tumor-suppressive microRNA-29 family inhibits cancer cell migration and invasion directly targeting LOXL2 in lung squamous cell carcinoma. Int J Oncol. 2016;48(2):450–60.

    Article  CAS  PubMed  Google Scholar 

  11. Qu J, Li M, An J, Zhao B, Zhong W, Gu Q, Cao L, Yang H, Hu C. MicroRNA-33b inhibits lung adenocarcinoma cell growth, invasion, and epithelial-mesenchymal transition by suppressing Wnt/beta-catenin/ZEB1 signaling. Int J Oncol. 2015;47(6):2141–52.

    Article  CAS  PubMed  Google Scholar 

  12. D’Angelo E, Zanon C, Sensi F, Digito M, Rugge M, Fassan M, Scarpa M, Pucciarelli S, Nitti D, Agostini M. miR-194 as predictive biomarker of responsiveness to neoadjuvant chemoradiotherapy in patients with locally advanced rectal adenocarcinoma. J Clin Pathol. 2018;71(4):344–50.

    Article  PubMed  CAS  Google Scholar 

  13. D’Angelo E, Fassan M, Maretto I, Pucciarelli S, Zanon C, Digito M, Rugge M, Nitti D, Agostini M. Serum miR-125b is a non-invasive predictive biomarker of the pre-operative chemoradiotherapy responsiveness in patients with rectal adenocarcinoma. Oncotarget. 2016;7(19):28647–57.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Perilli L, Vicentini C, Agostini M, Pizzini S, Pizzi M, D’Angelo E, Bortoluzzi S, Mandruzzato S, Mammano E, Rugge M, et al. Circulating miR-182 is a biomarker of colorectal adenocarcinoma progression. Oncotarget. 2014;5(16):6611–9.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Labbaye C, Testa U. The emerging role of MIR-146A in the control of hematopoiesis, immune function and cancer. J Hematol Oncol. 2012;5:13.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Czajka AA, Wojcicka A, Kubiak A, Kotlarek M, Bakula-Zalewska E, Koperski L, Wiechno W, Jazdzewski K. Family of microRNA-146 regulates RARbeta in papillary thyroid carcinoma. PLoS ONE. 2016;11(3):e0151968.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  17. Yao Q, Tu C, Lu D, Zou Y, Liu H, Zhang S. Clinicopathological significance of the microRNA-146a/WASP-family verprolin-homologous protein-2 axis in gastric cancer. Cancer Sci. 2017;108(7):1285–92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Hurst DR, Edmonds MD, Scott GK, Benz CC, Vaidya KS, Welch DR. Breast cancer metastasis suppressor 1 up-regulates miR-146, which suppresses breast cancer metastasis. Can Res. 2009;69(4):1279–83.

    Article  CAS  Google Scholar 

  19. Li YL, Wang J, Zhang CY, Shen YQ, Wang HM, Ding L, Gu YC, Lou JT, Zhao XT, Ma ZL, et al. MiR-146a-5p inhibits cell proliferation and cell cycle progression in NSCLC cell lines by targeting CCND1 and CCND2. Oncotarget. 2016;7(37):59287–98.

    PubMed  PubMed Central  Google Scholar 

  20. Sun Q, Zhao X, Liu X, Wang Y, Huang J, Jiang B, Chen Q, Yu J. miR-146a functions as a tumor suppressor in prostate cancer by targeting Rac1. Prostate. 2014;74(16):1613–21.

    Article  CAS  PubMed  Google Scholar 

  21. Bleau AM, Redrado M, Nistal-Villan E, Villalba M, Exposito F, Redin E, de Aberasturi AL, Larzabal L, Freire J, Gomez-Roman J, et al. miR-146a targets c-met and abolishes colorectal cancer liver metastasis. Cancer Lett. 2018;414:257–67.

    Article  CAS  PubMed  Google Scholar 

  22. Dweep H, Sticht C, Pandey P, Gretz N. miRWalk–database: prediction of possible miRNA binding sites by “walking” the genes of three genomes. J Biomed Inform. 2011;44(5):839–47.

    Article  CAS  PubMed  Google Scholar 

  23. Dweep H, Gretz N. miRWalk2.0: a comprehensive atlas of microRNA-target interactions. Nat Methods. 2015;12(8):697.

    Article  CAS  PubMed  Google Scholar 

  24. Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017;45(W1):W98–102.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Chen G, Umelo IA, Lv S, Teugels E, Fostier K, Kronenberger P, Dewaele A, Sadones J, Geers C, De Greve J. miR-146a inhibits cell growth, cell migration and induces apoptosis in non-small cell lung cancer cells. PLoS ONE. 2013;8(3):e60317.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Gan BL, He RQ, Zhang Y, Wei DM, Hu XH, Chen G. Downregulation of HOXA3 in lung adenocarcinoma and its relevant molecular mechanism analysed by RT-qPCR, TCGA and in silico analysis. Int J Oncol. 2018;53(4):1557–79.

    CAS  PubMed  PubMed Central  Google Scholar 

  27. Huang WT, He RQ, Li XJ, Ma J, Peng ZG, Zhong JC, Hu XH, Chen G. miR146a5p targets TCSF and influences cell growth and apoptosis to repress NSCLC progression. Oncol Rep. 2019;41(4):2226–40.

    PubMed  PubMed Central  Google Scholar 

  28. Guo YN, Luo B, Chen WJ, Chen X, Peng ZG, Wei KL, Chen G. Comprehensive clinical implications of homeobox A10 in 3,199 cases of non-small cell lung cancer tissue samples combining qRT-PCR, RNA sequencing and microarray data. Am J Transl Res. 2019;11(1):45–66.

    PubMed  PubMed Central  Google Scholar 

  29. Yang X, Deng Y, He RQ, Li XJ, Ma J, Chen G, Hu XH. Upregulation of HOXA11 during the progression of lung adenocarcinoma detected via multiple approaches. Int J Mol Med. 2018;42(5):2650–64.

    CAS  PubMed  PubMed Central  Google Scholar 

  30. Zhang R, Zhang TT, Zhai GQ, Guo XY, Qin Y, Gan TQ, Zhang Y, Chen G, Mo WJ, Feng ZB. Evaluation of the HOXA11 level in patients with lung squamous cancer and insights into potential molecular pathways via bioinformatics analysis. World J Surg Oncol. 2018;16(1):109.

    Article  PubMed  PubMed Central  Google Scholar 

  31. Deng Y, He R, Zhang R, Gan B, Zhang Y, Chen G, Hu X. The expression of HOXA13 in lung adenocarcinoma and its clinical significance: a study based on The Cancer Genome Atlas, Oncomine and reverse transcription-quantitative polymerase chain reaction. Oncol Lett. 2018;15(6):8556–72.

    PubMed  PubMed Central  Google Scholar 

  32. Zhang Y, Li XJ, He RQ, Wang X, Zhang TT, Qin Y, Zhang R, Deng Y, Wang HL, Luo DZ, et al. Upregulation of HOXA1 promotes tumorigenesis and development of nonsmall cell lung cancer: a comprehensive investigation based on reverse transcription-quantitative polymerase chain reaction and bioinformatics analysis. Int J Oncol. 2018;53(1):73–86.

    CAS  PubMed  PubMed Central  Google Scholar 

  33. Luo Z, Li X, Zhao Z, Yang X, Xiao S, Zhou Y. MicroRNA-146a affects the chemotherapeutic sensitivity and prognosis of advanced gastric cancer through the regulation of LIN52. Oncol Lett. 2017;13(3):1386–92.

    Article  CAS  PubMed  Google Scholar 

  34. Zavala V, Perez-Moreno E, Tapia T, Camus M, Carvallo P. miR-146a and miR-638 in BRCA1-deficient triple negative breast cancer tumors, as potential biomarkers for improved overall survival. Cancer Biomark. 2016;16(1):99–107.

    Article  CAS  PubMed  Google Scholar 

  35. Hess AK, Muer A, Mairinger FD, Weichert W, Stenzinger A, Hummel M, Budach V, Tinhofer I. MiR-200b and miR-155 as predictive biomarkers for the efficacy of chemoradiation in locally advanced head and neck squamous cell carcinoma. Eur J Cancer. 2017;77:3–12.

    Article  CAS  PubMed  Google Scholar 

  36. Hou Z, Xie L, Yu L, Qian X, Liu B. MicroRNA-146a is down-regulated in gastric cancer and regulates cell proliferation and apoptosis. Medical oncology (Northwood, London, England). 2012;29(2):886–92.

    Article  CAS  Google Scholar 

  37. Kogo R, Mimori K, Tanaka F, Komune S, Mori M. Clinical significance of miR-146a in gastric cancer cases. Clin Cancer Res. 2011;17(13):4277–84.

    Article  CAS  PubMed  Google Scholar 

  38. Li J, Yang H, Li Y, Liu Y, Chen S, Qi C, Zhang Q, Lan T, He X, Guan XY, et al. microRNA-146 up-regulation predicts the prognosis of non-small cell lung cancer by miRNA in situ hybridization. Exp Mol Pathol. 2014;96(2):195–9.

    Article  CAS  PubMed  Google Scholar 

  39. Paik JH, Jang JY, Jeon YK, Kim WY, Kim TM, Heo DS, Kim CW. MicroRNA-146a downregulates NFkappaB activity via targeting TRAF6 and functions as a tumor suppressor having strong prognostic implications in NK/T cell lymphoma. Clin Cancer Res. 2011;17(14):4761–71.

    Article  CAS  PubMed  Google Scholar 

  40. Wang Y, Li Z, He C, Wang D, Yuan X, Chen J, Jin J. MicroRNAs expression signatures are associated with lineage and survival in acute leukemias. Blood Cells Mol Dis. 2010;44(3):191–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Zhong H, Xu L, Zhong JH, Xiao F, Liu Q, Huang HH, Chen FY. Clinical and prognostic significance of miR-155 and miR-146a expression levels in formalin-fixed/paraffin-embedded tissue of patients with diffuse large B-cell lymphoma. Exp Ther Med. 2012;3(5):763–70.

    Article  PubMed  PubMed Central  Google Scholar 

  42. Adams BD, Parsons C, Walker L, Zhang WC, Slack FJ. Targeting noncoding RNAs in disease. J Clin Investig. 2017;127(3):761–71.

    Article  PubMed  PubMed Central  Google Scholar 

  43. Eichmuller SB, Osen W, Mandelboim O, Seliger B. Immune modulatory microRNAs involved in tumor attack and tumor immune escape. J Natl Cancer Inst. 2017. https://doi.org/10.1093/jnci/djx034.

    Article  PubMed  Google Scholar 

  44. Peta E, Sinigaglia A, Masi G, Di Camillo B, Grassi A, Trevisan M, Messa L, Loregian A, Manfrin E, Brunelli M, et al. HPV16 E6 and E7 upregulate the histone lysine demethylase KDM2B through the c-MYC/miR-146a-5p axys. Oncogene. 2018;37(12):1654–68.

    Article  CAS  PubMed  Google Scholar 

  45. Cui Y, She K, Tian D, Zhang P, Xin X. miR-146a inhibits proliferation and enhances chemosensitivity in epithelial ovarian cancer via reduction of SOD2. Oncol Res. 2016;23(6):275–82.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Wilczynski M, Zytko E, Szymanska B, Dzieniecka M, Nowak M, Danielska J, Stachowiak G, Wilczynski JR. Expression of miR-146a in patients with ovarian cancer and its clinical significance. Oncol Lett. 2017;14(3):3207–14.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  47. Shomali N, Mansoori B, Mohammadi A, Shirafkan N, Ghasabi M, Baradaran B. MiR-146a functions as a small silent player in gastric cancer. Biomed Pharmacother. 2017;96:238–45.

    Article  CAS  PubMed  Google Scholar 

  48. Li H, Xie S, Liu M, Chen Z, Liu X, Wang L, Li D, Zhou Y. The clinical significance of downregulation of mir-124-3p, mir-146a-5p, mir-155-5p and mir-335-5p in gastric cancer tumorigenesis. Int J Oncol. 2014;45(1):197–208.

    Article  CAS  PubMed  Google Scholar 

  49. Papaconstantinou IG, Manta A, Gazouli M, Lyberopoulou A, Lykoudis PM, Polymeneas G, Voros D. Expression of microRNAs in patients with pancreatic cancer and its prognostic significance. Pancreas. 2013;42(1):67–71.

    Article  CAS  PubMed  Google Scholar 

  50. Ali S, Ahmad A, Aboukameel A, Ahmed A, Bao B, Banerjee S, Philip PA, Sarkar FH. Deregulation of miR-146a expression in a mouse model of pancreatic cancer affecting EGFR signaling. Cancer Lett. 2014;351(1):134–42.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Rong M, He R, Dang Y, Chen G. Expression and clinicopathological significance of miR-146a in hepatocellular carcinoma tissues. Upsala J Med Sci. 2014;119(1):19–24.

    Article  PubMed  PubMed Central  Google Scholar 

  52. Huang S, He R, Rong M, Dang Y, Chen G. Synergistic effect of MiR-146a mimic and cetuximab on hepatocellular carcinoma cells. Biomed Res Int. 2014;2014:384121.

    PubMed  PubMed Central  Google Scholar 

  53. Lu D, Yao Q, Zhan C, Le-Meng Z, Liu H, Cai Y, Tu C, Li X, Zou Y, Zhang S. MicroRNA-146a promote cell migration and invasion in human colorectal cancer via carboxypeptidase M/src-FAK pathway. Oncotarget. 2017;8(14):22674–84.

    PubMed  PubMed Central  Google Scholar 

  54. Liu H, Ren G, Zhu L, Liu X, He X. The upregulation of miRNA-146a inhibited biological behaviors of ESCC through inhibition of IRS2. Tumour Biol. 2016;37(4):4641–7.

    Article  CAS  PubMed  Google Scholar 

  55. Wang C, Guan S, Liu F, Chen X, Han L, Wang D, Nesa EU, Wang X, Bao C, Wang N, et al. Prognostic and diagnostic potential of miR-146a in oesophageal squamous cell carcinoma. Br J Cancer. 2016;114(3):290–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  56. Wang C, Zhang W, Zhang L, Chen X, Liu F, Zhang J, Guan S, Sun Y, Chen P, Wang D, et al. miR-146a-5p mediates epithelial-mesenchymal transition of oesophageal squamous cell carcinoma via targeting Notch2. Br J Cancer. 2018;118(6):e12.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  57. Zhan B, Lu D, Luo P, Wang B. Prognostic value of expression of MicroRNAs in non-small cell lung cancer: a systematic review and meta-analysis. Clin Lab. 2016;62(11):2203–11.

    PubMed  Google Scholar 

  58. Lerner C, Wemmert S, Bochen F, Kulas P, Linxweiler M, Hasenfus A, Heinzelmann J, Leidinger P, Backes C, Meese E, et al. Characterization of miR-146a and miR-155 in blood, tissue and cell lines of head and neck squamous cell carcinoma patients and their impact on cell proliferation and migration. J Cancer Res Clin Oncol. 2016;142(4):757–66.

    Article  CAS  PubMed  Google Scholar 

  59. Kumaraswamy E, Wendt KL, Augustine LA, Stecklein SR, Sibala EC, Li D, Gunewardena S, Jensen RA. BRCA1 regulation of epidermal growth factor receptor (EGFR) expression in human breast cancer cells involves microRNA-146a and is critical for its tumor suppressor function. Oncogene. 2015;34(33):4333–46.

    Article  CAS  PubMed  Google Scholar 

  60. Fukami K, Inanobe S, Kanemaru K, Nakamura Y. Phospholipase C is a key enzyme regulating intracellular calcium and modulating the phosphoinositide balance. Prog Lipid Res. 2010;49(4):429–37.

    Article  CAS  PubMed  Google Scholar 

  61. Kadamur G, Ross EM. Mammalian phospholipase C. Annu Rev Physiol. 2013;75:127–54.

    Article  CAS  PubMed  Google Scholar 

  62. Raimondi C, Falasca M. Phosphoinositides signalling in cancer: focus on PI3K and PLC. Adv Biol Regul. 2012;52(1):166–82.

    Article  CAS  PubMed  Google Scholar 

  63. Lattanzio R, Piantelli M, Falasca M. Role of phospholipase C in cell invasion and metastasis. Adv Biol Regul. 2013;53(3):309–18.

    Article  CAS  PubMed  Google Scholar 

  64. Cai S, Sun PH, Resaul J, Shi L, Jiang A, Satherley LK, Davies EL, Ruge F, Douglas-Jones A, Jiang WG, et al. Expression of phospholipase C isozymes in human breast cancer and their clinical significance. Oncol Rep. 2017;37(3):1707–15.

    Article  CAS  PubMed  Google Scholar 

  65. Ertao Z, Jianhui C, Chuangqi C, Changjiang Q, Sile C, Yulong H, Hui W, Shirong C. Autocrine Sonic hedgehog signaling promotes gastric cancer proliferation through induction of phospholipase Cgamma1 and the ERK1/2 pathway. J Exp Clin Cancer Res. 2016;35:63.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  66. Ma LW, Zhou ZT, He QB, Jiang WW. Phospholipase C-gamma1 expression correlated with cancer progression of potentially malignant oral lesions. J Oral Pathol Med. 2013;42(1):47–52.

    Article  CAS  PubMed  Google Scholar 

  67. Zhu D, Tan Y, Yang X, Qiao J, Yu C, Wang L, Li J, Zhang Z, Zhong L. Phospholipase C gamma 1 is a potential prognostic biomarker for patients with locally advanced and resectable oral squamous cell carcinoma. Int J Oral Maxillofac Surg. 2014;43(12):1418–26.

    Article  CAS  PubMed  Google Scholar 

  68. Paris L, Cecchetti S, Spadaro F, Abalsamo L, Lugini L, Pisanu ME, Iorio E, Natali PG, Ramoni C, Podo F. Inhibition of phosphatidylcholine-specific phospholipase C downregulates HER2 overexpression on plasma membrane of breast cancer cells. BCR. 2010;12(3):R27.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  69. Balz LM, Bartkowiak K, Andreas A, Pantel K, Niggemann B, Zanker KS, Brandt BH, Dittmar T. The interplay of HER2/HER3/PI3 K and EGFR/HER2/PLC-gamma1 signalling in breast cancer cell migration and dissemination. J Pathol. 2012;227(2):234–44.

    Article  CAS  PubMed  Google Scholar 

  70. Verkman AS. Aquaporins in clinical medicine. Annu Rev Med. 2012;63:303–16.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  71. Beitz E, Golldack A, Rothert M, von Bulow J. Challenges and achievements in the therapeutic modulation of aquaporin functionality. Pharmacol Ther. 2015;155:22–35.

    Article  CAS  PubMed  Google Scholar 

  72. Noda Y, Sohara E, Ohta E, Sasaki S. Aquaporins in kidney pathophysiology. Nat Rev Nephrol. 2010;6(3):168–78.

    Article  CAS  PubMed  Google Scholar 

  73. Kortenoeven ML, Fenton RA. Renal aquaporins and water balance disorders. Biochem Biophys Acta. 2014;1840(5):1533–49.

    Article  CAS  PubMed  Google Scholar 

  74. Wang J, Feng L, Zhu Z, Zheng M, Wang D, Chen Z, Sun H. Aquaporins as diagnostic and therapeutic targets in cancer: how far we are? J Transl Med. 2015;13:96.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  75. Wang L, Zhang Y, Wu X, Yu G. Aquaporins: new targets for cancer therapy. Technol Cancer Res Treat. 2016;15(6):821–8.

    Article  CAS  PubMed  Google Scholar 

  76. Ribatti D, Ranieri G, Annese T, Nico B. Aquaporins in cancer. Biochem Biophys Acta. 2014;1840(5):1550–3.

    Article  CAS  PubMed  Google Scholar 

  77. Garg R, Benedetti LG, Abera MB, Wang H, Abba M, Kazanietz MG. Protein kinase C and cancer: what we know and what we do not. Oncogene. 2014;33(45):5225–37.

    Article  CAS  PubMed  Google Scholar 

  78. Caino MC, Lopez-Haber C, Kissil JL, Kazanietz MG. Non-small cell lung carcinoma cell motility, rac activation and metastatic dissemination are mediated by protein kinase C epsilon. PLoS ONE. 2012;7(2):e31714.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  79. Zhang N, Su Y, Xu L. Targeting PKCepsilon by miR-143 regulates cell apoptosis in lung cancer. FEBS Lett. 2013;587(22):3661–7.

    Article  CAS  PubMed  Google Scholar 

  80. Toton E, Ignatowicz E, Skrzeczkowska K, Rybczynska M. Protein kinase Cepsilon as a cancer marker and target for anticancer therapy. PR. 2011;63(1):19–29.

    CAS  PubMed  Google Scholar 

  81. Basu A. PKCepsilon paves the way for prostate cancer. Cell Cycle. 2011;10(3):378.

    Article  CAS  PubMed  Google Scholar 

  82. Huang B, Cao K, Li X, Guo S, Mao X, Wang Z, Zhuang J, Pan J, Mo C, Chen J, et al. The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma. J Exp Clin Cancer Res. 2011;30:88.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  83. Datta J, Smith A, Lang JC, Islam M, Dutt D, Teknos TN, Pan Q. microRNA-107 functions as a candidate tumor-suppressor gene in head and neck squamous cell carcinoma by downregulation of protein kinase Cvarepsilon. Oncogene. 2012;31(36):4045–53.

    Article  CAS  PubMed  Google Scholar 

  84. Gorin MA, Pan Q. Protein kinase C epsilon: an oncogene and emerging tumor biomarker. Molecular cancer. 2009;8:9.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  85. Brownlow N, Pike T, Crossland V, Claus J, Parker P. Regulation of the cytokinesis cleavage furrow by PKCepsilon. Biochem Soc Trans. 2014;42(6):1534–7.

    Article  CAS  PubMed  Google Scholar 

  86. Zhang X, Li D, Li M, Ye M, Ding L, Cai H, Fu D, Lv Z. MicroRNA-146a targets PRKCE to modulate papillary thyroid tumor development. Int J Cancer. 2014;134(2):257–67.

    Article  PubMed  CAS  Google Scholar 

  87. Schenone S, Brullo C, Musumeci F, Biava M, Falchi F, Botta M. Fyn kinase in brain diseases and cancer: the search for inhibitors. Curr Med Chem. 2011;18(19):2921–42.

    Article  CAS  PubMed  Google Scholar 

  88. Saito YD, Jensen AR, Salgia R, Posadas EM. Fyn: a novel molecular target in cancer. Cancer. 2010;116(7):1629–37.

    Article  CAS  PubMed  Google Scholar 

  89. Elias D, Ditzel HJ. Fyn is an important molecule in cancer pathogenesis and drug resistance. Pharmacol Res. 2015;100:250–4.

    Article  CAS  PubMed  Google Scholar 

  90. Lewin B, Siu A, Baker C, Dang D, Schnitt R, Eisapooran P, Ramos DM. Expression of Fyn kinase modulates EMT in oral cancer cells. Anticancer Res. 2010;30(7):2591–6.

    CAS  PubMed  Google Scholar 

  91. Chen JS, Hung WS, Chan HH, Tsai SJ, Sun HS. In silico identification of oncogenic potential of fyn-related kinase in hepatocellular carcinoma. Bioinformatics. 2013;29(4):420–7.

    Article  PubMed  CAS  Google Scholar 

  92. Alexanian A, Miller B, Chesnik M, Mirza S, Sorokin A. Post-translational regulation of COX2 activity by FYN in prostate cancer cells. Oncotarget. 2014;5(12):4232–43.

    Article  PubMed  PubMed Central  Google Scholar 

  93. Verkman AS, Anderson MO, Papadopoulos MC. Aquaporins: important but elusive drug targets. Nat Rev Drug Discov. 2014;13(4):259–77.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  94. Papadopoulos MC, Saadoun S, Verkman AS. Aquaporins and cell migration. Pflugers Arch. 2008;456(4):693–700.

    Article  CAS  PubMed  Google Scholar 

  95. Tomita Y, Dorward H, Yool AJ, Smith E, Townsend AR, Price TJ, Hardingham JE. Role of Aquaporin 1 signalling in cancer development and progression. Int J Mol Sci. 2017;18(2):299.

    Article  PubMed Central  CAS  Google Scholar 

  96. Wang Y, Fan Y, Zheng C, Zhang X. Knockdown of AQP1 inhibits growth and invasion of human ovarian cancer cells. Mol Med Rep. 2017;16(4):5499–504.

    Article  CAS  PubMed  Google Scholar 

  97. Park JY, Yoon G. Overexpression of Aquaporin-1 is a prognostic factor for biochemical recurrence in prostate adenocarcinoma. POR. 2017;23(1):189–96.

    CAS  PubMed  Google Scholar 

  98. Sun WJ, Hu DH, Wu H, Xiao H, Lu MD, Guo WJ, Huang H, Yu YJ, Hu TY, Zheng ZQ. Expression of AQP1 was associated with apoptosis and survival of patients in gastric adenocarcinoma. Dig Surg. 2016;33(3):190–6.

    Article  CAS  PubMed  Google Scholar 

  99. Kang BW, Kim JG, Lee SJ, Chae YS, Jeong JY, Yoon GS, Park SY, Kim HJ, Park JS, Choi GS, et al. Expression of aquaporin-1, aquaporin-3, and aquaporin-5 correlates with nodal metastasis in colon cancer. Oncology. 2015;88(6):369–76.

    Article  CAS  PubMed  Google Scholar 

  100. Yamazato Y, Shiozaki A, Ichikawa D, Kosuga T, Shoda K, Arita T, Konishi H, Komatsu S, Kubota T, Fujiwara H, et al. Aquaporin 1 suppresses apoptosis and affects prognosis in esophageal squamous cell carcinoma. Oncotarget. 2018;9(52):29957–74.

    Article  PubMed  PubMed Central  Google Scholar 

  101. El Hindy N, Bankfalvi A, Herring A, Adamzik M, Lambertz N, Zhu Y, Siffert W, Sure U, Sandalcioglu IE. Correlation of aquaporin-1 water channel protein expression with tumor angiogenesis in human astrocytoma. Anticancer Res. 2013;33(2):609–13.

    PubMed  Google Scholar 

  102. Wei X, Dong J. Aquaporin 1 promotes the proliferation and migration of lung cancer cell in vitro. Oncol Rep. 2015;34(3):1440–8.

    Article  CAS  PubMed  Google Scholar 

  103. Esteva-Font C, Jin BJ, Verkman AS. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice. FASEB J. 2014;28(3):1446–53.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  104. Qin F, Zhang H, Shao Y, Liu X, Yang L, Huang Y, Fu L, Gu F, Ma Y. Expression of aquaporin1, a water channel protein, in cytoplasm is negatively correlated with prognosis of breast cancer patients. Oncotarget. 2016;7(7):8143–54.

    Article  PubMed  PubMed Central  Google Scholar 

  105. Liu J, Zhang WY, Ding DG. Expression of aquaporin 1 in bladder uroepithelial cell carcinoma and its relevance to recurrence. APJCP. 2015;16(9):3973–6.

    PubMed  Google Scholar 

  106. Jagirdar RM, Apostolidou E, Molyvdas PA, Gourgoulianis KI, Hatzoglou C, Zarogiannis SG. Influence of AQP1 on cell adhesion, migration, and tumor sphere formation in malignant pleural mesothelioma is substratum- and histological-type dependent. Am J Physiol Lung Cell Mol Physiol. 2016;310(6):L489–95.

    Article  PubMed  Google Scholar 

  107. Ihara T, Hosokawa Y, Kumazawa K, Ishikawa K, Fujimoto J, Yamamoto M, Muramkami T, Goshima N, Ito E, Watanabe S, et al. An in vivo screening system to identify tumorigenic genes. Oncogene. 2017;36(14):2023–9.

    Article  CAS  PubMed  Google Scholar 

  108. Furuta K, Arao T, Sakai K, Kimura H, Nagai T, Tamura D, Aomatsu K, Kudo K, Kaneda H, Fujita Y, et al. Integrated analysis of whole genome exon array and array-comparative genomic hybridization in gastric and colorectal cancer cells. Cancer Sci. 2012;103(2):221–7.

    Article  CAS  PubMed  Google Scholar 

  109. Makondi PT, Chu CM, Wei PL, Chang YJ. Prediction of novel target genes and pathways involved in irinotecan-resistant colorectal cancer. PloS ONE. 2017;12(7):e0180616.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  110. Li YX, Jin HG, Yan CG, Ren CY, Jiang CJ, Jin CD, Seo KS, Jin X. Molecular cloning, sequence identification, and gene expression analysis of bovine ADCY2 gene. Mol Biol Rep. 2014;41(6):3561–8.

    Article  CAS  PubMed  Google Scholar 

  111. Shen JX, Cooper DM. AKAP79, PKC, PKA and PDE4 participate in a Gq-linked muscarinic receptor and adenylate cyclase 2 cAMP signalling complex. Biochem J. 2013;455(1):47–56.

    Article  CAS  PubMed  Google Scholar 

  112. Duerr EM, Mizukami Y, Ng A, Xavier RJ, Kikuchi H, Deshpande V, Warshaw AL, Glickman J, Kulke MH, Chung DC. Defining molecular classifications and targets in gastroenteropancreatic neuroendocrine tumors through DNA microarray analysis. Endocrine Relat Cancer. 2008;15(1):243–56.

    Article  CAS  Google Scholar 

  113. Sato T, Arai E, Kohno T, Tsuta K, Watanabe S, Soejima K, Betsuyaku T, Kanai Y. DNA methylation profiles at precancerous stages associated with recurrence of lung adenocarcinoma. PloS ONE. 2013;8(3):e59444.

    Article  PubMed  PubMed Central  Google Scholar 

  114. Chen H, Cai W, Chu ESH, Tang J, Wong CC, Wong SH, Sun W, Liang Q, Fang J, Sun Z, et al. Hepatic cyclooxygenase-2 overexpression induced spontaneous hepatocellular carcinoma formation in mice. Oncogene. 2017;36(31):4415–26.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This study was supported by funds from the National Natural Science Foundation of China (NSFC81560469, NSFC81360327, NSFC81760420), Natural Science Foundation of Guangxi, China (2017GXNSFAA198016, 2016GXNSFAA380255), and Guangxi Medical University Training Program for Distinguished Young Scholars and Medical Excellence Award Funded by the Creative Research Development Grant from the First Affiliated Hospital of Guangxi Medical University.

Author information

Author notes

  1. Mei-wei Li and Li Gao contributed equally as first authors.

Authors and Affiliations

  1. Department of Pathology, First Affiliated Hospital of Guangxi Medical University, 6 Shuangyong Road, Nanning, 530021, Guangxi Zhuang Autonomous Region, P. R. China

    Mei-wei Li, Li Gao, Yi-wu Dang, Ping Li, Zu-yun Li, Gang Chen & Dian-zhong Luo

Authors
  1. Mei-wei Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Li Gao
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yi-wu Dang
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Ping Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Zu-yun Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Gang Chen
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Dian-zhong Luo
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

M-wL and LG analyzed and interpreted the patient data, and were two major contributor in writing the manuscript. Y-wD and PL participated in literature search and data collection. GC and D-zL participated in the design of the study and funds collection. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Zu-yun Li or Gang Chen.

Ethics declarations

Ethics approval and consent to participate

The Ethical Committees of First Affiliated Hospital, Guangxi Medical University, China have approved the study protocol. And all of the patients have signed the informed consent.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Li, Mw., Gao, L., Dang, Yw. et al. Protective potential of miR-146a-5p and its underlying molecular mechanism in diverse cancers: a comprehensive meta-analysis and bioinformatics analysis. Cancer Cell Int 19, 167 (2019). https://doi.org/10.1186/s12935-019-0886-y

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12935-019-0886-y

Keywords

Cancer Cell International

ISSN: 1475-2867

Contact us