Skip to main content
Download PDF

NEK7 promotes gastric cancer progression as a cell proliferation regulator

Cancer Cell International volume 21, Article number: 438 (2021) Cite this article

Abstract

Background

Gastric cancer is one of the most common malignant tumors of the digestive system. However, its targeted therapy develops at a slow pace. Thus, exploring the mechanisms of the malignant behavior of gastric cancer cells is crucial to exploit its treatment. Mammalian never-in-mitosis A (NIMA)-related kinases (NEKs) are considered to play a significant role in cancer cell proliferation. However, no study has reported on NIMA family proteins in gastric cancer.

Methods

Bioinformatics analysis was employed to clarify the expression patterns of NEK1–NEK11 and their effects on prognosis. The effects of NEK7 on immune infiltration and NEK7 related pathways were also analyzed. At the cell level, 5-ethynyl-2-deoxyuridine, cell cycle, and Cell Counting Kit-8 assays were utilized to clarify the effect of NEK7 on gastric cancer cell proliferation. A mouse subcutaneous model revealed the regulating effect of NEK7 on gastric cancer cell proliferation in vivo.

Results

Bioinformatics analysis revealed that NEK7 is upregulated in gastric cancer and is related to poor prognosis. NEK7 is also related to T-stage, which is closely associated with cell proliferation. Further analysis showed that NEK7 was correlated with infiltration of multiple immune cells as well as gastric cancer-related pathways. Cell experiments indicated the promoting effect of NEK7 on cell proliferation, while the absence of NEK7 could lead to inhibition of gastric cancer proliferation and G1/S arrest.

Conclusion

NEK7 exerts a regulatory effect on cell proliferation and is closely related to tumor immune infiltration.

Background

Cancer is a leading cause of death and a huge barrier to extending life expectancy worldwide. According to the statistics published on CA by the American Cancer Society in 2021, gastric cancer is the sixth leading cause of cancer-related deaths, and approximately one million new cases of gastric cancer were recorded, while more than 780 thousand deaths were reported in 2020 [1]. For all tumors, immortalization is the most basic characteristic, so targeting cell proliferation is an essential concept in cancer therapy for decades. However, the targeted therapy for gastric cancer develops slowly. Thus, shedding new light on the mechanism of gastric cancer cell proliferation is significant to develop new therapeutic methods and early screening.

The proliferation of eukaryotic cells, including cancer cells, relies on mitosis with a stable cell cycle. The stability of the cell cycle is maintained by many regulatory proteins, especially by kinases [2]. Abnormal expression of cell cycle-related kinases could accelerate the cell cycle and result in inappropriate proliferation. Mammalian never-in-mitosis A (NIMA)-related kinases (NEK proteins) are a group of positive regulatory proteins of the cell cycle that could regulate microtubules and promote mitosis. Expressions of NEK proteins are higher in various malignant tissues than in normal tissues. Moreover, ectopic expressions and genetic variations of NEK proteins are higher in tumor tissues. These unusual expressions of NEK proteins could lead to cell cycle dysregulation and eventually cancer [2].

In 1975, Morris investigated mitotic mutants of Aspergillus nidulans and found that Aspergillus nidulans never goes through mitosis A [3]. NIMA kinases were named after nidulans protein kinases that are encoded by the NIMA gene. They are a kind of serine–threonine kinases that are needed during mitosis [3, 4]. Since its discovery, 11 genetically different NIMA kinases (NEK1–NEK11) were identified in most eukaryotes, including humans. As regards the function of NEK proteins, previous studies have shown that NEK2, NEK6, NEK7, and NEK9 mainly participate in G2-M key point regulation, promote the maturity of the centrosome, and influence chromosome condensation as well as spindle formation in mitosis, while NEK1, NEK10, and NEK11 are involved in DNA damage response [5, 6].

We analyzed the expressions of NIMA kinases and their effects on prognosis synthetically and found that only NEK7 is upregulated in gastric cancer and exerted a significant effect on gastric cancer prognosis. A previous study showed that NEK7 is activated by the direct connection of NEK9 through allosteric and non-allosteric mechanisms in mitosis. Moreover, NEK7 controls phosphorylation of kinesin KIF11 and recruitment to the centrosome; as a result, the centrosome separates [7]. Thereafter, NEK7 participates in spindle assembly through phosphorylated heat shock protein NUP98 and controls cytokinesis through the regulation of motile kinesin Mklp2 as well as kinesin KIF14 [8]. Salem et al. found that lack of NEK7 could cause death in late embryonic and early postnatal periods as well as severe developmental retardation through the development and analysis of NEK7-defected mice. Meanwhile, mouse embryonic fibroblasts tended to present lagging chromosome, micronucleus formation, and cytokinesis failure [9].

Recent research presented that NEK7 was mainly connected with NLRP3 inflammasome. NEK7 could activate inflammasome NLRP3 to produce numerous polykaryocytes and apoptotic cells, which are closely related to inflammation, and then cause inflammation in the body [10, 11]. The effects of the NEK7–NLRP3 axis on diabetic retinal degeneration, systemic lupus erythematosus, and gout have already been evaluated [12,13,14,15]. Meanwhile, Eisa et al. found that the expression of NEK7 could promote cell division in cancer [16]. Zhang et al. found that NEK7 is frequently upregulated in retinoblastoma cell lines, while NEK7 knockdown by virus-mediated RNA interference could significantly inhibit cell growth as well as colony formation and arrest in the G0/G1 phase [17]. Zhou et al. also found that the expression of NEK7 is significantly higher in hepatoma cell lines than in normal liver cell lines. Furthermore, virus-mediated NEK7 silencing could inhibit the growth of hepatocellular carcinoma cell lines and tumor cells on the xenotransplantation model in immunodeficient mice [18]. Although those studies have revealed the connection between NEK7 and malignancies, NEK7 has not yet been reported in gastric cancer.

Methods

Cell culture

Two human gastric cancer cell lines MKN-45, MGC-803, and HEK-293 T were purchased from Beyotime Biotechnology (Shanghai, China). All cells were cultured in a medium containing 90%DMEM + 10%FBS + 1%P/S.

Construction of NEK7 knockdown cell line

Plasmids that expressed shRNA-1 (CATTCTCGAAGAGTCATGCATAGAGATATAAAACCAGCTAA) and shRNA-2 (GAAGGCCTTACGACCGGATATGGGCTATAATACATTAGCCA) were designed. The lentiviral plasmids were constructed by the Public Protein/Plasmid Library.

After screening, shRNA-1 was used to construct stable knockdown cell lines. The lentivirus packaging kit (Gmeasy-40, Genomeditech) was then utilized.

Protein extraction

Cells were cultured in 100-mm Petri dish until their density reached 70–90%. Radioimmunoprecipitation medium (P00103C, Beyotime Biotechnology) was used to extract total protein from cultured cells. Then, cells were boiled for 10 min after adding loading buffer (CoWin Biosciences, MA, USA).

Reverse-transcription polymerase chain reaction (RT-PCR)

MKN-45 and MGC-803 were treated with Trizol and RNA was extracted following the manufacturer’s instructions. The RNA was dissolved in 10–100 µl of diethylpyrocarbonate-treated water, and dilution was appropriately performed for quantification. The RNA was measured by UV spectrophotometry and reverse transcribed into cDNA using a reverse transcription kit.

RNA expression was assayed by real-time PCR set to 95 ℃ for 30 s, 55 ℃ for 30 s, and 72 ℃ for 7 min and repeated for 40 circulations. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was utilized as an endogenous control. All quantitative RT-PCR reactions were performed three times independently. The relative RNA expression levels were calculated using the 2−△△Ct method.

Western blot (WB)

Protease inhibition was used to extract total protein from cell lysis of MKN-45 and MGC-803. Bicinchoninic acid protein assay kit was used to measure protein concentration. Protein was separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis in appropriate concentration and transformed onto polyvinylidene fluoride membranes. After blocking for 1 h at 4 ℃ using tris-buffered saline with Tween® 20 (TBST) brewed skim milk powder, the membrane was incubated overnight with the anti-NEK7 (ab13514, abcam, UK) antibody and anti-GAPDH (ab8245, abcam) antibody, which was diluted to an appropriate concentration. Then, after washing, the membrane was incubated with the second antibody at 4 ℃ for at least 1 h and washed by TBST three times. The anti-CDK4 (Cat No. 11026-1-AP), anti-CCND2 (Cat No. 10934-1-AP), anti-KIF3A (Cat No. 13930-1-AP), anti-AKT3 (Cat No. 21641-1-AP), and anti-PRKG1 (Cat No. 21646-1-AP) antibodies were purchased from the Proteintech Group (IL, USA). Signals were detected using a chemiluminescence system (SensiCapture imaging system, Peiqing Technology Co. LTD, China).

5-Ethynyl-2-deoxyuridine (EdU) to stain proliferating cells

EdU staining was utilized to analyze MKN-45 and MGC-803 cells with normal and downregulation of NEK7 expression. The EdU buffer and cell medium were mixed in a ratio of 1:1000 and added into the plate (2 ml in each well) and then incubated at 37 ℃ for 2 h. The medium was discarded, and after washing, phosphate-buffered saline (PBS) with 4% paraformaldehyde was added (2 ml each well) for cell fixation (37 ℃, 30 min). Then, the cells were permeabilized with 0.5% Triton X-100 and cultured for 10 min. The EdU staining solution was added, and the nuclei were stained with 4′,6-diamidino-2-phenylindole. The results could be visualized under a fluorescence microscope.

Cell Counting Kit-8 (CCK-8) assay

MKN-45 and MGC-803 cells were suspended and seeded into 96-well plates. After being incubated at 37℃ for 24 h, 10 µl of CCK-8 solution (US Everbright Inc., China) was added to each well. The absorbance was measured by a microplate reader at 450 nm after being incubated for 4 h in a dark environment.

Flow cytometry

The treated cells were collected and fixed with chilled 75% ethanol at − 20 °C overnight or longer. After ethanol was being discarded, cells were washed twice with PBS and then stained with cell cycle and apoptosis kit (C6031, UE, China) at room temperature for 30 min. Moreover, 400 μL of PBS or 1 × binding buffer was added to each tube. The selection between PBS and 1 × binding buffer was decided based on the apoptosis method and cell type. Then, cell apoptosis was analyzed immediately through flow cytometry. YF488-Annexin V was excited at 488 nm. The fluorescence emission spectrum was detected at 530 nm (fluorescein isothiocyanate channel), and the emission spectrum of the PI channel was detected at 617 nm. Cell cycle analysis was performed on the flow cytometry (FACS LSRII, BD Bioscience, China).

Animal studies

shNC and shNEK7 cells were collected and suspended in pre-cooled PBS and subcutaneously injected into the mice (1 × 107/100 µl per mouse). Twelve mice were used in total, and the negative control (n = 6) and experimental (n = 6) groups included randomly selected mice (room condition: temperature 20–26 ℃, relative humidity 40–70%, light and darkness alternate every 12 h) The mice were sacrificed at the end of the experiment (day 26). The removed tumors were used in immunohistochemistry (IHC) staining and WB. The experiments were approved by the Ethics Committee of the First Hospital of Lanzhou University (LDYYLL2021-179).

Bioinformatics analysis and statistics

The differential gene expression in tumor and normal tissues and the correlation between protein expression and clinical prognosis of patients with gastric cancer were analyzed by GEPIA (http://gepia.cancer-pku.cn/) tool. The correlation analysis between NEK7 expression and immune infiltration level was performed using TIMER 2.0 (http://timer.cistrome.org/). GraphPad Prism 8.0 software (GraphPad Software Inc., La Jolla, CA) was also used to analyze the results. As for the quantitative PCR assay, the relative RNA expression levels were calculated using the 2−△△Ct method (*p < 0.05, **p < 0.01, NS, not significant).

Results

NEK7 is highly expressed in gastric cancer cells and may be implicated in poor prognosis

We synthetically analyzed the expression of NIMA kinases (NEK1–NEK11) (Fig. 1a–k) in gastric cancer tissues and normal tissues. The correlation between NEK protein expression and clinical prognosis of patients with gastric cancer was also analyzed (Fig. 1l–v). The results showed that only the expression level of NEK7 was upregulated in gastric cancer (|LogFC|> 1, p < 0.01 was significant) and predicted poor survival prognosis (Fig. 1w).

Fig. 1
figure 1

The expression levels of NEKs and their effect on prognosis. a–k Expression of NEK1–NEK11 in tumor and normal tissues (red boxes, tumor; gray boxes, normal tissue). l–v. Correlation among the expressions of NEK1–NEK11 and OS, PPS, and FP. w. The Venn diagram shows the intersection between the expression level changes and survival. FP first progression, OS overall survival, PPS post-progression survival

Full size image

NEK7 is related to gastric cancer staging

We obtained RNA-seq (RNA-sequencing) data and the corresponding clinical information of 375 gastric cancer samples in The Cancer Genome Atlas Stomach Adenocarcinoma (TCGA-STAD) dataset to analyze the relationship between NEK7 expression level and clinical–pathological grading (Fig. 2e) and staging (Fig. 2a–d). The expression level of NEK7 in the late pT stage is higher than that in the early stage (Fig. 2f). The results indicated that the high expression of NEK7 may be implicated in the late T stage and high pathological grade. Complete clinicopathological information is listed in Table 1.

Fig. 2
figure 2

NEK7 expression effects the TNM staging and pathological grading. a–d The stacked diagram shows the percentage of each stage of the TNM staging at different NEK7 expression levels. The horizontal axis represents the samples with high or low NEK7 expressions, and the vertical axis represents clinical information contained in the corresponding grouped samples analyzed with p-value by chi-square test. For significance, the value is -log10 (p-value). *Significant difference (p < 0.05). a Percentage of pT staging. b Percentage of pN staging. c Percentage of pM staging. d Percentage of pTNM staging. e The stacked diagram shows the percentage of pathological grading at different NEK7 expression levels. f The box plot shows NEK7 expression levels in samples of different pT stages

Full size image
Table 1 Patients’ clinicopathological information
Full size table

NEK7 is associated with immune cell infiltration

TIMER 2.0 was used to analyze the effect of NEK7 on immune infiltration. The expression of NEK7 is positively related to the infiltration of Treg cells (Fig. 3a), macrophages (Fig. 3b), monocytes (Fig. 3c), neutrophils (Fig. 3d), and M2 macrophages (Fig. 3e) in gastric cancer, even if it has no distinct correlation with infiltration of M1 macrophages (Fig. 3f). Overall, the results demonstrated that immune cell infiltration could be affected by NEK7.

Fig. 3
figure 3

The correlation between NEK7 and immune infiltration. a Tregs infiltration is positively related to the NEK7 expression level. b Monocyte infiltration is positively related to the NEK7 expression level. c Neutrophil infiltration is positively related to the NEK7 expression level. d Macrophage infiltration is positively related to the NEK7 expression level. e Macrophage M2 infiltration is positively related to the NEK7 expression level. f Macrophage M1 infiltration is negatively related to the NEK7 expression level

Full size image

NEK7 is related to an important pathway of cell proliferation

By using RNA-seq data of gastric cancer from TCGA, we analyzed genetic correlation and obtained a gene map positively and negatively associated with NEK7 (Fig. 4a–c). Then, enrichment analysis on GO-BP and Kyoto Encyclopedia of Genes and Genomes (KEGG) (Fig. 4d–f) were performed. The results of the GO-BP analysis indicated that NEK7 was closely related to cell–cell adhesion via plasma membrane adhesion molecule pathway and multicellular organismal signaling pathway. Besides, NEK7 was positively related to the cell junction pathway. These results demonstrated that NEK7 was significant in regulating multicellular signaling and intracellular proliferation-related pathways. Moreover, we clarified the relationship between NEK7 and the aforementioned pathways by gene set enrichment analysis (GSEA) (Fig. 4g). Similar to the results of the KEGG analysis, GSEA showed that NEK7 was positively related to the cGMP-PKG signaling pathway, focal adhesion, extracellular matrix–receptor interaction, and Hedgehog signaling pathway. These pathways were found to be closely related to cancer progression. Moreover, using WB assay, the levels of the cGMP-PKG signaling pathway-related proteins (CCND4 and KIF3A) and Hedgehog signaling pathway-related proteins (AKT3 and PRKG1) after NEK7 administration were downregulated (Additional file 1: Fig. S1a). The results demonstrated that NEK7 downregulation could influence cGMP-PKG and Hedgehog signaling pathways through the downregulation of related proteins. The bioinformatics analysis showed the same results (Additional file 1: Fig. S1b).

Fig. 4
figure 4

Analysis of NEK7 and relative signaling pathways. a The volcano plot shows the genes associated with NEK7. b The heat map shows the first 50 pathways positively related to NEK7. c The heat map shows the first 50 pathways negatively related to NEK7. d Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of gene pathways associated with NEK7. e Gene ontology analysis of gene pathways associated with NEK7. f Gene ontology-biological processes analysis shows pathways associated with NEK7. g Gene set enrichment analysis (GSEA) shows the relationship between NEK7 and cGMP-PKG signaling pathway, focal adhesion, extracellular matrix (ECM)-receptor interaction, and Hedgehog signaling pathway

Full size image

NEK7 could promote proliferation of gastric cancer cells in vitro

NEK7-downregulated in vitro gastric cancer models were established based on MGC-803 and MKN-45 cells. WB and quantitative RT-PCR analysis were conducted to detect the effect of NEK7 silencing (Fig. 5a, b). Then, CCK-8 assay (Fig. 5c), flow cytometry (Fig. 5d, e), and EDU assay (Fig. 5f, g) were utilized to investigate the effect of NEK7 on gastric cancer cell proliferation. The results showed that downregulation of NEK7 could inhibit proliferation of gastric cancer cells, reduce the proportion of neoplastic gastric cancer cells, and lead to cell cycle G1/S arrest. Besides, we detected the expression levels of cell cycle-related proteins such as CDK4 and CCND2 with NEK7 downregulation through western blot (WB) assay (Additional file 1: Fig. S1a). The results showed that CCND2 was downregulated, but CDK4 expression was not significantly different. The bioinformatics analysis by gene expression profiling interactive analysis (GEPIA) showed the same results (Additional file 1: Fig. S1b) The aforementioned results show that NEK7 could promote gastric cancer cell proliferation.

Fig. 5
figure 5

The effect of NEK7 on cell cycle. a, b The shRNA-mediated NEK7 repression and NEK7 overexpression were confirmed by western blot assay and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) after lentivirus infection in the MGC-803 and MKN-45 cells. c Cell Counting Kit-8 (CCK-8) assay compares the OD450 values of shNEK7 cells and negative control over time. d, e The result of flow cytometry shows the effect of NEK7 on the cell cycle. f, g 5-Ethynyl-2-deoxyuridine (EdU) assay and its statistical result show the effect of NEK7 on cell proliferation

Full size image

NEK7 could promote gastric cancer proliferation in vivo

Further, we focused on MKN45 cells and injected MKN45-shNC and MKN45-shNEK7 subcutaneously in mice (Fig. 6a). The growth of the subcutaneous tumor was monitored (Fig. 6b, c). The mice were sacrificed and dissected after 26 days. The removed subcutaneous tumors were weighed. Then, WB was performed to detect the expression level of NEK7 (Fig. 6d). Moreover, IHC was utilized to detect the expression levels of NEK7 and MKI-67 (Fig. 6e). The results indicated that the tumor volume and mass of the experimental group injected with stable MKN45-shNEK7 cells were significantly lower than those in the control group injected with MKN45-shNC cells. WB and IHC showed that the NEK7 expression levels of the experimental group were significantly lower than those of the control group. In brief, these results demonstrate that NEK7 could promote gastric cancer cell proliferation in vivo. Ultimately, NEK7 could promote gastric cancer cell proliferation both in vitro and vivo.

Fig. 6
figure 6

The tumor inhibition caused by absence of NEK7 in vitro. a–c NEK7 knockdown effectively suppressed subcutaneous tumor growth of gastric cancer in nude mice, and the tumor weight and size were quantitatively analyzed. d Western blot assay confirmed the expression of NEK7 in the subcutaneous tumor. e IHC (NEK7) stained and IHC (KI67) paraffin-embedded sections obtained from the MKN45-shNC and MKN45-shNEK7 subcutaneous tumors

Full size image

Discussion

New cases of gastric cancer are increasing, and gastric cancer ranks fifth among malignancies and fourth as regards mortality worldwide. Moreover, the development of targeted therapy in gastric cancer is more limited than those in non-small cell lung cancer, chronic myelogenous leukemia, and liver cancer. Although the HER-2 targeted pathway, vascular endothelial growth factor pathway, and immune checkpoints have been widely used, the overall prognosis of patients with gastric cancer has not been revolutionized. Cell proliferation is a basic strategy of targeted therapy, so its mechanism and relationship with immune regulation are clinically worth exploring.

NEKs are a group of proteins whose domains are identical to NIMA. Some NEKs were related to tumor progression, such as breast cancer and colorectal cancer. In this study, the results of the bioinformatic analysis showed that among NEKs, the expressions of NEK2, NEK6, and NEK7 are upregulated, whereas NEK3 and NEK7 are related to the poor prognosis of gastric cancer. Thus, NEK7 was selected in this study as it shows differences in both expression levels and effects on prognosis.

The cGMP-PKG and Hedgehog signaling pathways could influence tumor cell fate determination and are closely related to the development of tumors [19,20,21]. According to Xiang et al., the cGMP-PKG pathway is related to gastric cancer caused by Helicobacter pylori [22]. Besides, Lv et al. showed that the cGMP-PKG pathway could enhance breast cancer stemness and metastasis [19]. The Hedgehog signaling pathway can promote tumor angiogenesis, metastasis, and stemness. Our data indicate that NEK7 participates in cancer cell proliferation and is related to the clinical stage as well as pathological grade. Moreover, NEK7 has a potential regulatory function in the cGMP-PKG pathway and Hedgehog signaling pathway.

Immune infiltration analysis shows that NEK7 is closely related to the infiltration of macrophages, especially M2 macrophage that could promote gastric cancer metastasis, cell proliferation, and tumor progression [23]. NEK7 could interact with NLRP3 and plays an important role in inflammatory response and determination of macrophage fate [24]. We hold the view that NEK7 could promote gastric cancer progression through not only regulation of cancer cell proliferation directly but also cell interaction, which could regulate immune infiltration and changes in immune cell subsets. In addition, GO and KEGG analyses indicate that NEK7 has a close relationship with several intercellular and matrix-related signaling pathways.

Ultimately, we revealed how NEK7 promotes gastric cancer proliferation and analyze the mechanism of promoting the progression of gastric cancer (Additional file 2).

Availability of data and materials

The datasets used and/or analyzed during the current study can be acquired from the corresponding author upon reasonable request.

Abbreviations

NIMA:

Never-in-mitosis A

GC:

Gastric cancer

EdU:

5-Ethynyl-2-deoxyuridine

CCK-8:

Cell counting kit-8

STAD:

Stomach adenocarcinoma

RIP:

RNA immunoprecipitation

acRIP:

Ac4C-RNA immunoprecipitation

TCGA:

The cancer genome atlas

GEPIA:

Gene expression profiling and interactive analyses

shRNA:

Short hairpin RNA

qRT-PCR:

Quantitative real-time PCR

WB:

Western blot

IHC:

Immunohistochemistry

GO-BP:

Gene ontology biological process

GSEA:

Gene set enrichment analysis

References

  1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424. https://doi.org/10.3322/caac.21492 (Epub 2018 Sep 12. Erratum in: CA Cancer J Clin. 2020 Jul;70(4):313. PMID: 30207593).

    Article  Google Scholar 

  2. Grallert B, Boye E. The Gcn2 kinase as a cell cycle regulator. Cell Cycle. 2007;6(22):2768–72. https://doi.org/10.4161/cc.6.22.4933 (Epub 2007 Aug 22. PMID: 17986863).

    Article  PubMed  CAS  Google Scholar 

  3. Morris NR. Mitotic mutants of Aspergillus nidulans. Genet Res. 1975;26(3):237–54. https://doi.org/10.1017/s0016672300016049 (PMID: 773766).

    Article  PubMed  CAS  Google Scholar 

  4. Oakley BR, Morris NR. A mutation in Aspergillus nidulans that blocks the transition from interphase to prophase. J Cell Biol. 1983;96(4):1155–8. https://doi.org/10.1083/jcb.96.4.1155.PMID:6339527;PMCID:PMC2112314.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  5. Fry AM, Bayliss R, Roig J. Mitotic regulation by NEK kinase networks. Front Cell Dev Biol. 2017;1(5):102. https://doi.org/10.3389/fcell.2017.00102.PMID:29250521;PMCID:PMC5716973.

    Article  Google Scholar 

  6. Matossian MD, Wells CI, Zuercher WJ, Collins-Burow BM, Drewry DH, Burow ME. Targeting never-in-mitosis-a related kinase 5 in cancer: a review. Curr Med Chem. 2021. https://doi.org/10.2174/0929867328666210322101749 (Epub ahead of print. PMID: 33749548).

    Article  PubMed  Google Scholar 

  7. Sun Z, Gong W, Zhang Y, Jia Z. Physiological and pathological roles of mammalian NEK7. Front Physiol. 2020;7(11): 606996. https://doi.org/10.3389/fphys.2020.606996.PMID:33364979;PMCID:PMC7750478.

    Article  Google Scholar 

  8. Cullati SN, Kabeche L, Kettenbach AN, Gerber SA. A bifurcated signaling cascade of NIMA-related kinases controls distinct kinesins in anaphase. J Cell Biol. 2017;216(8):2339–54. https://doi.org/10.1083/jcb.201512055 (Epub 2017 Jun 19. PMID: 28630147; PMCID: PMC5551695).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  9. Salem H, Rachmin I, Yissachar N, Cohen S, Amiel A, Haffner R, Lavi L, Motro B. Nek7 kinase targeting leads to early mortality, cytokinesis disturbance and polyploidy. Oncogene. 2010;29(28):4046–57. https://doi.org/10.1038/onc.2010.162 (Epub 2010 May 17 PMID: 20473324).

    Article  PubMed  CAS  Google Scholar 

  10. Xu J, Lu L, Li L. NEK7: a novel promising therapy target for NLRP3-related inflammatory diseases. Acta Biochim Biophys Sin (Shanghai). 2016;48(10):966–8. https://doi.org/10.1093/abbs/gmw080 (Epub 2016 Aug 25 PMID: 27563009).

    Article  CAS  Google Scholar 

  11. Sharif H, Wang L, Wang WL, Magupalli VG, Andreeva L, Qiao Q, Hauenstein AV, Wu Z, Núñez G, Mao Y, Wu H. Structural mechanism for NEK7-licensed activation of NLRP3 inflammasome. Nature. 2019;570(7761):338–43. https://doi.org/10.1038/s41586-019-1295-z (Epub 2019 Jun 12. PMID: 31189953; PMCID: PMC6774351).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  12. Cai H, Wang P, Zhang B, Dong X. Expression of the NEK7/NLRP3 inflammasome pathway in patients with diabetic lower extremity arterial disease. BMJ Open Diabetes Res Care. 2020;8(2): e001808. https://doi.org/10.1136/bmjdrc-2020-001808.PMID:33323459;PMCID:PMC7745315.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Zhang Y, Lv X, Hu Z, Ye X, Zheng X, Ding Y, Xie P, Liu Q. Protection of Mcc950 against high-glucose-induced human retinal endothelial cell dysfunction. Cell Death Dis. 2017;8(7): e2941. https://doi.org/10.1038/cddis.2017.308.PMID:28726778;PMCID:PMC5550855.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  14. Ma ZZ, Sun HS, Lv JC, Guo L, Yang QR. Expression and clinical significance of the NEK7-NLRP3 inflammasome signaling pathway in patients with systemic lupus erythematosus. J Inflamm (Lond). 2018;3(15):16. https://doi.org/10.1186/s12950-018-0192-9.PMID:30202244;PMCID:PMC6122698.

    Article  Google Scholar 

  15. Lin Y, Luo T, Weng A, Huang X, Yao Y, Fu Z, Li Y, Liu A, Li X, Chen D, Pan H. Gallic acid alleviates gouty arthritis by inhibiting NLRP3 inflammasome activation and pyroptosis through enhancing Nrf2 signaling. Front Immunol. 2020;7(11): 580593. https://doi.org/10.3389/fimmu.2020.580593.PMID:33365024;PMCID:PMC7750458.

    Article  Google Scholar 

  16. Eisa NH, Jilani Y, Kainth K, Redd P, Lu S, Bougrine O, Abdul Sater H, Patwardhan CA, Shull A, Shi H, Liu K, Elsherbiny NM, Eissa LA, El-Shishtawy MM, Horuzsko A, Bollag R, Maihle N, Roig J, Korkaya H, Cowell JK, Chadli A. The co-chaperone UNC45A is essential for the expression of mitotic kinase NEK7 and tumorigenesis. J Biol Chem. 2019;294(14):5246–60. https://doi.org/10.1074/jbc.RA118.006597 (Epub 2019 Feb 8. PMID: 30737284; PMCID: PMC6462532).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  17. Zhang J, Wang L, Zhang Y. Downregulation of NIMA-related kinase-7 inhibits cell proliferation by inducing cell cycle arrest in human retinoblastoma cells. Exp Ther Med. 2018;15(2):1360–6. https://doi.org/10.3892/etm.2017.5558 (Epub 2017 Nov 23. PMID: 29434721; PMCID: PMC5774400).

    Article  PubMed  CAS  Google Scholar 

  18. Zhou L, Wang Z, Xu X, Wan Y, Qu K, Fan H, Chen Q, Sun X, Liu C. Nek7 is overexpressed in hepatocellular carcinoma and promotes hepatocellular carcinoma cell proliferation in vitro and in vivo. Oncotarget. 2016;7(14):18620–30. https://doi.org/10.18632/oncotarget.7620.PMID:26921196;PMCID:PMC4951314.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Lv Y, Wang X, Li X, Xu G, Bai Y, Wu J, Piao Y, Shi Y, Xiang R, Wang L. Nucleotide de novo synthesis increases breast cancer stemness and metastasis via cGMP-PKG-MAPK signaling pathway. PLoS Biol. 2020;18(11): e3000872. https://doi.org/10.1371/journal.pbio.3000872.PMID:33186350;PMCID:PMC7688141.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  20. Kong X, Wang JS, Yang H. Upregulation of lncRNA DARS-AS1 accelerates tumor malignancy in cervical cancer by activating cGMP-PKG pathway. J Biochem Mol Toxicol. 2021;35(6):1–11. https://doi.org/10.1002/jbt.22749 (Epub 2021 Feb 25 PMID: 33634536).

    Article  PubMed  CAS  Google Scholar 

  21. Jiang J. Hedgehog signaling mechanism and role in cancer. Semin Cancer Biol. 2021. https://doi.org/10.1016/j.semcancer.2021.04.003 (S1044-579X(21)00104-8. Epub ahead of print. PMID: 33836254).

    Article  PubMed  Google Scholar 

  22. Xiang T, Yuan C, Guo X, Wang H, Cai Q, Xiang Y, Luo W, Liu G. The novel ZEB1-upregulated protein PRTG induced by Helicobacter pylori infection promotes gastric carcinogenesis through the cGMP/PKG signaling pathway. Cell Death Dis. 2021;12(2):150. https://doi.org/10.1038/s41419-021-03440-1.PMID:33542225;PMCID:PMC7862680.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  23. Yang X, Cai S, Shu Y, Deng X, Zhang Y, He N, Wan L, Chen X, Qu Y, Yu S. Exosomal miR-487a derived from m2 macrophage promotes the progression of gastric cancer. Cell Cycle. 2021;20(4):434–44. https://doi.org/10.1080/15384101.2021.1878326 (Epub 2021 Jan 31. PMID: 33522393; PMCID: PMC7894454).

    Article  PubMed  CAS  Google Scholar 

  24. Schmid-Burgk JL, Chauhan D, Schmidt T, Ebert TS, Reinhardt J, Endl E, Hornung V. A genome-wide CRISPR (clustered regularly interspaced short palindromic repeats) screen identifies NEK7 as an essential component of NLRP3 inflammasome activation. J Biol Chem. 2016;291(1):103–9. https://doi.org/10.1074/jbc.C115.700492 (Epub 2015 Nov 9. PMID: 26553871; PMCID: PMC4697147).

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgements

We thank Mr. Yigan Zhang for his expert technical assistance.

Funding

The study was partially supported by the National Key Research and Development Program of China (no.2017FYA0205302) to Wei-Lin Jin.

Author information

Author notes

  1. Yike Li and Xiaoran Zhu have equal contributions

Authors and Affiliations

  1. Wenzhou Medical University, Wenzhou, 325035, People’s Republic of China

    Yi-Ke Li

  2. The First School of Clinical Medicine, Lanzhou University, Lanzhou, 730000, People’s Republic of China

    Xiao-Ran Zhu, Wen-Zhen Yuan & Wei-Lin Jin

  3. Medical Pioneer Innovation Center, The First Hospital of Lanzhou University, Lanzhou, 730000, People’s Republic of China

    Xiao-Ran Zhu, Yue Zhan, Wen-Zhen Yuan & Wei-Lin Jin

  4. Department of General Surgery, The First Hospital of Lanzhou University, Lanzhou, 730000, People’s Republic of China

    Wen-Zhen Yuan

  5. Institute of Cancer Neuroscience, The First Hospital of Lanzhou University, Lanzhou, 730000, People’s Republic of China

    Xiao-Ran Zhu & Wei-Lin Jin

  6. School of Basic Medical Science, Lanzhou University, Lanzhou, 730000, People’s Republic of China

    Yue Zhan

Authors
  1. Yi-Ke Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Xiao-Ran Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yue Zhan
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Wen-Zhen Yuan
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Wei-Lin Jin
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

W-LJ, W-ZY, Y-KL, and X-RZ conceived and designed the study. Y-KL, X-RZ and YZ conducted the experiments. Y-KL and X-RZ performed the statistical analysis of the pathological data and drafted the manuscript. All authors have read and approved the final manuscript.

Corresponding authors

Correspondence to Wen-Zhen Yuan or Wei-Lin Jin.

Ethics declarations

Ethics approval and consent to participate

This study was approved by the Ethics Committee of the First Hospital of Lanzhou University (LDYYLL2021-179). GC tissue microarrays were purchased from Shanghai Outdo Biotech.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Fig. S1

. NEK7 effect on relative signaling pathway-related proteins. a. Expression levels of cell cycle-related proteins (CDK4 and CCND2), Hedgehog signaling pathway-related proteins (CCND2 and KIF3A), and cGMP-PKG signaling pathway-related proteins (AKT3 and PRKG1) with shNC and shNEK7 detected by western blot assay. b. Gene expression profiling interactive analysis (GEPIA) of the correlation among NEK7 and cell cycle-related proteins (CDK4 and CCND2), Hedgehog signaling pathway-related proteins (CCND2 and KIF3A), and cGMP-PKG signaling pathway-related proteins (AKT3 and PRKG1).

Additional file 2

. Original data.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Li, YK., Zhu, XR., Zhan, Y. et al. NEK7 promotes gastric cancer progression as a cell proliferation regulator. Cancer Cell Int 21, 438 (2021). https://doi.org/10.1186/s12935-021-02148-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12935-021-02148-8

Cancer Cell International

ISSN: 1475-2867

Contact us