Cell culture
Two human gastric cancer cell lines MKN-45, MGC-803, and HEK-293 T were purchased from Beyotime Biotechnology (Shanghai, China). All cells were cultured in a medium containing 90%DMEM + 10%FBS + 1%P/S.
Construction of NEK7 knockdown cell line
Plasmids that expressed shRNA-1 (CATTCTCGAAGAGTCATGCATAGAGATATAAAACCAGCTAA) and shRNA-2 (GAAGGCCTTACGACCGGATATGGGCTATAATACATTAGCCA) were designed. The lentiviral plasmids were constructed by the Public Protein/Plasmid Library.
After screening, shRNA-1 was used to construct stable knockdown cell lines. The lentivirus packaging kit (Gmeasy-40, Genomeditech) was then utilized.
Protein extraction
Cells were cultured in 100-mm Petri dish until their density reached 70–90%. Radioimmunoprecipitation medium (P00103C, Beyotime Biotechnology) was used to extract total protein from cultured cells. Then, cells were boiled for 10 min after adding loading buffer (CoWin Biosciences, MA, USA).
Reverse-transcription polymerase chain reaction (RT-PCR)
MKN-45 and MGC-803 were treated with Trizol and RNA was extracted following the manufacturer’s instructions. The RNA was dissolved in 10–100 µl of diethylpyrocarbonate-treated water, and dilution was appropriately performed for quantification. The RNA was measured by UV spectrophotometry and reverse transcribed into cDNA using a reverse transcription kit.
RNA expression was assayed by real-time PCR set to 95 ℃ for 30 s, 55 ℃ for 30 s, and 72 ℃ for 7 min and repeated for 40 circulations. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was utilized as an endogenous control. All quantitative RT-PCR reactions were performed three times independently. The relative RNA expression levels were calculated using the 2−△△Ct method.
Western blot (WB)
Protease inhibition was used to extract total protein from cell lysis of MKN-45 and MGC-803. Bicinchoninic acid protein assay kit was used to measure protein concentration. Protein was separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis in appropriate concentration and transformed onto polyvinylidene fluoride membranes. After blocking for 1 h at 4 ℃ using tris-buffered saline with Tween® 20 (TBST) brewed skim milk powder, the membrane was incubated overnight with the anti-NEK7 (ab13514, abcam, UK) antibody and anti-GAPDH (ab8245, abcam) antibody, which was diluted to an appropriate concentration. Then, after washing, the membrane was incubated with the second antibody at 4 ℃ for at least 1 h and washed by TBST three times. The anti-CDK4 (Cat No. 11026-1-AP), anti-CCND2 (Cat No. 10934-1-AP), anti-KIF3A (Cat No. 13930-1-AP), anti-AKT3 (Cat No. 21641-1-AP), and anti-PRKG1 (Cat No. 21646-1-AP) antibodies were purchased from the Proteintech Group (IL, USA). Signals were detected using a chemiluminescence system (SensiCapture imaging system, Peiqing Technology Co. LTD, China).
5-Ethynyl-2-deoxyuridine (EdU) to stain proliferating cells
EdU staining was utilized to analyze MKN-45 and MGC-803 cells with normal and downregulation of NEK7 expression. The EdU buffer and cell medium were mixed in a ratio of 1:1000 and added into the plate (2 ml in each well) and then incubated at 37 ℃ for 2 h. The medium was discarded, and after washing, phosphate-buffered saline (PBS) with 4% paraformaldehyde was added (2 ml each well) for cell fixation (37 ℃, 30 min). Then, the cells were permeabilized with 0.5% Triton X-100 and cultured for 10 min. The EdU staining solution was added, and the nuclei were stained with 4′,6-diamidino-2-phenylindole. The results could be visualized under a fluorescence microscope.
Cell Counting Kit-8 (CCK-8) assay
MKN-45 and MGC-803 cells were suspended and seeded into 96-well plates. After being incubated at 37℃ for 24 h, 10 µl of CCK-8 solution (US Everbright Inc., China) was added to each well. The absorbance was measured by a microplate reader at 450 nm after being incubated for 4 h in a dark environment.
Flow cytometry
The treated cells were collected and fixed with chilled 75% ethanol at − 20 °C overnight or longer. After ethanol was being discarded, cells were washed twice with PBS and then stained with cell cycle and apoptosis kit (C6031, UE, China) at room temperature for 30 min. Moreover, 400 μL of PBS or 1 × binding buffer was added to each tube. The selection between PBS and 1 × binding buffer was decided based on the apoptosis method and cell type. Then, cell apoptosis was analyzed immediately through flow cytometry. YF488-Annexin V was excited at 488 nm. The fluorescence emission spectrum was detected at 530 nm (fluorescein isothiocyanate channel), and the emission spectrum of the PI channel was detected at 617 nm. Cell cycle analysis was performed on the flow cytometry (FACS LSRII, BD Bioscience, China).
Animal studies
shNC and shNEK7 cells were collected and suspended in pre-cooled PBS and subcutaneously injected into the mice (1 × 107/100 µl per mouse). Twelve mice were used in total, and the negative control (n = 6) and experimental (n = 6) groups included randomly selected mice (room condition: temperature 20–26 ℃, relative humidity 40–70%, light and darkness alternate every 12 h) The mice were sacrificed at the end of the experiment (day 26). The removed tumors were used in immunohistochemistry (IHC) staining and WB. The experiments were approved by the Ethics Committee of the First Hospital of Lanzhou University (LDYYLL2021-179).
Bioinformatics analysis and statistics
The differential gene expression in tumor and normal tissues and the correlation between protein expression and clinical prognosis of patients with gastric cancer were analyzed by GEPIA (http://gepia.cancer-pku.cn/) tool. The correlation analysis between NEK7 expression and immune infiltration level was performed using TIMER 2.0 (http://timer.cistrome.org/). GraphPad Prism 8.0 software (GraphPad Software Inc., La Jolla, CA) was also used to analyze the results. As for the quantitative PCR assay, the relative RNA expression levels were calculated using the 2−△△Ct method (*p < 0.05, **p < 0.01, NS, not significant).
