Skip to main content
Download PDF

Smad2/3/4 complex could undergo liquid liquid phase separation and induce apoptosis through TAT in hepatocellular carcinoma

Cancer Cell International volume 24, Article number: 176 (2024) Cite this article

Abstract

Background

Hepatocellular carcinoma (HCC) represents one of the most significant causes of mortality due to cancer-related deaths. It has been previously reported that the TGF-β signaling pathway may be associated with tumor progression. However, the relationship between TGF-β signaling pathway and HCC remains to be further elucidated. The objective of our research was to investigate the impact of TGF-β signaling pathway on HCC progression as well as the potential regulatory mechanism involved.

Methods

We conducted a series of bioinformatics analyses to screen and filter the most relevant hub genes associated with HCC. E. coli was utilized to express recombinant protein, and the Ni–NTA column was employed for purification of the target protein. Liquid liquid phase separation (LLPS) of protein in vitro, and fluorescent recovery after photobleaching (FRAP) were utilized to verify whether the target proteins had the ability to drive force LLPS. Western blot and quantitative real-time polymerase chain reaction (qPCR) were utilized to assess gene expression levels. Transcription factor binding sites of DNA were identified by chromatin immunoprecipitation (CHIP) qPCR. Flow cytometry was employed to examine cell apoptosis. Knockdown of target genes was achieved through shRNA. Cell Counting Kit-8 (CCK-8), colony formation assays, and nude mice tumor transplantation were utilized to test cell proliferation ability in vitro and in vivo.

Results

We found that Smad2/3/4 complex could regulate tyrosine aminotransferase (TAT) expression, and this regulation could relate to LLPS. CHIP qPCR results showed that the key targeted DNA binding site of Smad2/3/4 complex in TAT promoter region is −1032 to −1182. In addition. CCK-8, colony formation, and nude mice tumor transplantation assays showed that Smad2/3/4 complex could repress cell proliferation through TAT. Flow cytometry assay results showed that Smad2/3/4 complex could increase the apoptosis of hepatoma cells. Western blot results showed that Smad2/3/4 complex would active caspase-9 through TAT, which uncovered the mechanism of Smad2/3/4 complex inducing hepatoma cell apoptosis.

Conclusion

This study proved that Smad2/3/4 complex could undergo LLPS to active TAT transcription, then active caspase-9 to induce hepatoma cell apoptosis in inhibiting HCC progress. The research further elucidate the relationship between TGF-β signaling pathway and HCC, which contributes to discover the mechanism of HCC development.

Background

Hepatocellular carcinoma (HCC) is the most prevalent liver malignancy and is among the top leading causes of cancer-related mortality [1,2,3]. It is reported that genetic mutations, chromosomal aberrations, molecular signaling pathways, and epigenetic deregulation have been implicated in HCC [4], but the mechanism of HCC development still remains ambiguity. Therefore, to reveal the mechanism of HCC development in a new sight is critical to solve this problem.

Previous studies showed that TGF-β signaling is a double edge sword in HCC development. As a tumor suppressor, it inhibits HCC development through upregulate the cyclin-dependent kinase (CDK) inhibitor genes p15, p21, and p27 [5]. As a tumor promotor, it induce HCC invasion and epithelial-to-mesenchymal transition (EMT) through active pro-EMT inducers, such as TWIST1, TCF3, E12, SNAI1, SLUG, ZEB1 [6,7,8]. These researches suggest that TGF-β signaling pathway may switch from being tumor-suppression to tumor-promoting in HCC progress [9].

It is reported that TGF-β signaling pathway is dysregulated in many cancers [10]. TGF-β can suppress tumors directly by regulating cell differentiation and apoptosis, or indirectly by suppressing inflammation and stroma-derived mitogens [11,12,13,14]. Surprisingly, the TGF-β signaling pathway can also induce tumor cell migration and stimulate the epithelial to mesenchymal transition [10, 11]. The TGF-β signaling pathway is activated by TGF-β binding to TGF-β type II and type I receptors (TβR II and TβR I), which are active serine/threonine kinases, then TβRI was phosphorylated. Activated TβRI phosphorylates Smad2 and Smad3, which assemble heterodimeric and trimeric complexes with Smad4. Smad2/3/4 complexes translocate to the nucleus and regulate target gene expression [8, 10].

Smad2/3 and Smad4 assemble Smad2/3/4 complex then translocate to the nucleus and regulate target gene expression when TGF-β signaling is activated [10]. Studies show that transcription factors can undergo LLPS with mediator to activate gene expression [15]. Transcription coactivators, such as BRD4 and MED1, can also form phase-separated droplets to control gene expression [16]. Smad2/3/4 complex is a well known transcription factor. In this study, we proved that Smad2/3/4 complex could undergo LLPS to active gene expression.

Phase separation takes part in some physiological activities [17,18,19]. Such as cytoskeleton formation [20], RNA metabolism [21], nucleolar formation [22] and transcription [15, 16]. LLPS can reflect the highly dynamic changes of macromolecular substances in solution. The phase separation of protein and protein (or protein and nucleic acid) can form liquid droplets to activate or inhibit biochemical reactions. Recently, LLPS is reported to have relationship with pathologic process, for instance, rare genetic disease [23], neurodegenerative disease [17] and cancer [24]. It is reported that LLPS can affect the progress of HCC. For example, LLPS of glycogen encapsulates YAP into glycogen droplets, inhibits the activation of Hippo pathway and drives the occurrence of HCC [24]. The Twist1-YY1-p300 complex promotes miR-9 expression through LLPS, stimulates hepatoma cell invasion and metastasis [25]. All these researches suggest that LLPS is related to HCC progress. In our research, we found that the LLPS of Smad2/3/4 complex could inhibit HCC progress.

Previous studies show that the disturbance of tyrosine metabolism is related to cancer progress [26]. In addition, clinical patients with hereditary tyrosinemia are more likely to develop HCC [27, 28]. In HCC patients, serum tyrosine is often upregulated [29, 30]. These suggest that tyrosine metabolism imbalance is related to HCC process. The TAT gene encodes a mitochondrial protein tyrosine aminotransferase which is present in liver. TAT involves in tyrosine breakdown and converts tyrosine to p-hydroxyphenylpyruvate. In previous research, TAT acts as a tumor suppressive player in HCC [31]. The regulatory mechanism of TAT expression still remains unknown. In our research, we found that Smad2/3/4 complex would undergo LLPS to regulate TAT expression.

In this study, we found that Smad2/3/4 may activate TAT expression through liquid liquid phase separation. The CCK-8 and colony formation assays results showed that Smad2/3/4 complex inhibited HCC progress was related to TAT. Western-Blot and Flow cytometry assays results suggested that Smad2/3/4 complex could active caspase-9 to improve hepatoma cell apoptosis through TAT. Our research further correlated TGF-β signaling pathway with apoptosis through TAT, enriched the function of LLPS, which brings new insights into the molecular mechanism of HCC.

Materials and methods

Western blot analysis

HUH7 and HepG2 cells were lysed with RIPA buffer. We used Future PAGE gel (ET12420gel; ACE Biotechnology, China) to separate protein. The eBlotTML1 machine (L00686C; Genescript, China) was used for transferred protein onto polyvinylidene fluoride membranes. The target proteins were detected using special antibody and visualized using the developer (UC279012; Thermo, USA). Antibody information: anti-β-actin antibody (AC038; Abclonal, Wuhan, China), anti- Smad2 antibody (A19114; Abclonal), anti-Smad3 antibody (A19115; Abclonala), anti-TAT antibody (A6764; Abclonal). anti-Smad4 antibody (A19116; Abclonala). anti-TAT antibody(A6764; Abclonal). anti-Caspase-9 antibody(A11910, A0281; Abclonala). Secondary antibodies: horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (H + L) (AS014; Abclonal). Original data of Western blot were showed in supplementary material.

QRT-PCR analysis

All cells and tumor tissues were lysed by RNAiso Plus (Takara Biotechnology, Dalian, China). Total RNA was extracted by chloroform and precipitated by isopropanol. The cDNA Synthesis Kit was used to synthesize first-strand cDNA (K1622, Thermo, USA). qRT-PCR was performed by PerfectStart® Green qPCR SuperMix according (AQ601, TransGen Biotech, Beijing, China) to the manufacturer’s protocol. The primers used were as follows: β-actin forward, 5’-GAGAAAATCTGGCACCACACC-3’, reverse, 5’-GGATAGCACAGCCTGGATAGCAA-3’; TAT forward, 5’- GAGTTCACGGAGCGGTTAGT-3’, reverse, 5’- ATCATCACCTCGGGGACTGT-3’; Smad2 forward, 5’-GCTTCTCTGAACAAACCAGGTC-3’, reverse, 5’-TGTGAAGATCAGGCCAGCG-3’; Smad3 forward, 5’-TCGTCCATCCTGCCTTTCAC-3’, reverse, 5’- CTGCCCCGTCTTCTTGAGTT-3’; Smad4 forward, 5’- ACTTTGAGGGACAGCCATCG-3’, reverse, 5’- GATGGGGCTAACAGAGCTGG;

CCK-8 analysis

Transfect HUH7 and HepG2 cells with target vector via lip3000 (Followed the Reagent instructions). Inoculated cell suspension in 96-well plate (1000–5000 cells/well), Pre-incubate the plate in cell incubator at 37 ℃ according to experimental need. Add equal to 1/10 of the media volume CCK-8 (FC101-01, TransGen Biotech, Beijing, China) solution to each well and then incubate the plate in 37 ℃ for 1–3 h. Used a microplate reader to measure the absorbance at 450 nm.

ELISA analysis

Treated cells were lysed using RIPA buffer, tumors were frozen with liquid nitrogen and grind, then also lysed using RIPA buffer. Lysed cell and tumor was centrifuged at high speed and collected supernatant. The supernatant was used Human TyR ELISA Kit (CB15676-Hu, Shanghai Coibo Bio Technology, Shanghai, China) to test the tyrosine content according to the manufacturer’s protocol. Using a microplate reader to measure the absorbance at 450 nm.

Virus package

We used the lentiviral system to knockdown the target genes. Sh-vector (with special shRNA sequence) and other two plasmids pMD2.G and pSPAX2 were co-transfected into HEK293T cells by lip3000 (L3000075, Thermo, USA). The viral supernatant was collected at least 40 h after transfection. The lentivirus was used to infect HUH7 and HepG2 cells for at least 24 h, and screened at least 7d with puromycin after infection. Western bolt and qPCR were used to check the knockdown efficiency. The shRNA sequence used for target gene konockdown were as follows: shRNA-Smad2-1: 5’-CAAGTACTCCTTGCTGGATTG-3’; shRNA-Smad2-2: 5’-GCGTTGCTCAAGCATGTCATA-3’; shRNA-Smad3-1: 5’-GAGCCTGGTCAAGAAACTCAA-3’; shRNA-Smad3-2: 5’-GCCTCAGTGACAGCGCTATTT-3’; shRNA-Smad4-1: 5’- GTACTTCATACCATGCCGATT-3’; shRNA-Smad4-2: 5’- GCTGCTGGAATTGGTGTTGAT-3’.

Recombinant protein expression and purify

We used E. coli to express recombinant protein (Tagged with EGFP/mCherry/EBFP), and protein (His tagged) was purified with Ni–NTA column. Target vector was transfected into E. coli and cultured in LB medium. Add IPTG to final concentration 0.24 mg/ml when medium OD value to 0.6–0.8. Continuing cultivate the E. coli for 16–24 h in 16–24 ℃, then collect the E. coli. Treat the bacteria with ultrasonic crusher (200W, 3 s on and 4 s off). Follow the protocol of Ni–NTA column to purify protein.

Phase separation in vitro

Purified proteins were diluted in PBS, added PEG8000 at a final concentration 10% (M/V). The solution is expected to turn cloudy if the peptide is prone to liquid liquid phase separation. Use different NaCl concentration and temperature to test the environmental effect of liquid droplets formation. The liquid droplets were used detected by fluorescence microscope or laser confocal microscope.

Flow cytometry

Transfect HUH7 and HepG2 cells with vectors through lip3000, and knock down target genes by lentivirus (shRNA). To test hepatoma cell apoptosis, a total of 4 × 105 cells per sample were prepared as signal-cell suspensions of the treated cells, and stained using the Annexin V-FITC Apoptosis Detection Kit(Cat: 556547, BD Bioscience, USA). The cells were analyzed by flow cytometry. Raw data were analyzed through the FlowJo_V10.8.1 software.

Tumor formation in nude mice

HUH7 cells well cultured in DMEM medium with 10% FBS and 1% penicillin streptomycin. Knock down of target genes by shRNA and screened at least 7d with puromycin. Pancreatic enzyme digestion the cells and count the numbers. Resuspend cells with the sodium chloride (0.9%). 1.5–2 × 106 tredted cells were injected in one 6-8w nude mice. Start record the tumor growth when the tumor length grown to 3–5 mm. When tumor volume growth to 1000–1500 mm3, all mice were sacrificed and the tumor tissues were used for further study.

CHIP qPCR

Collected hepatoma cells (HUH7 and HepG2), about 1–2 × 107 per sample. Wash the cells with PBS once, and fix cells by adding pre-warmed plain media supplement with the following reagents: Formaldehyde(1%), EDTA (pH 8.0, 0.15 mM), EGTA (pH 8.0, 0.075 mM), Hepes(pH 8.0, 0.015 mM). Keep cells at room temperature for 10 min to allow cross-linking, add glycine to a final concentration of 0.125 M to stop cross-linking. Rinse cells with cold PBS. Resuspend cells with BufferI(Hepes–KOH, PH7.5, 50 mM; NaCl, 140 mM; EDTA, 1 mM; glycerol, 10%; NP-40, 0.5%; Triton X-100, 0.25%). Rock at 4 ℃ for 10 min and spinning at 3000 rpm, 5 min. Resuspend cells with BufferII(NaCl, 200 mM; EDTA pH 8.0, 1 mM; EGTA pH 8.0, 0.5 mM; Tris pH 8.0, 10 mM). Rock at 4 ℃ for 10 min and spinning at 3000 rpm, 5 min. Resuspend cells with BufferIII(EDTA pH 8.0, 1 mM; EGTA pH 8.0, 0.5 mM; Tris pH 8.0, 10 mM; N-lauroyl-sarcosine, 0.5%). Sonicate the samples (30 s on 30 s off). Run 1% agarose gel with 10 ul of chromatin. A smear should be seen, that spans from 200 bp to 1 kb. Spin 14000 rpm, 10 min in microfuge at 4 ℃. TE buffer (Tris–HCl pH8.0, 10 mM; EDTA pH8.0, 1 mM) wash the ProteinA/G beads and BSA(1%) blocked it. Added the target antibody and rock in 4 ℃ for 16-24 h. Wash the beads with RIPA(Hepes pH 7.6, 50 mM; EDTA,10 mM; DOC, 0.7%; NP-40, 1%; LiCl, 0.5 mM) for 3 times. Wash the beads with Buffer (10 mM Tris pH 8.0/1 mM EDTA/ 50 mM NaCl) for 3 times. Resuspend sample with Buffer (50 mM Tris pH 8.0, 10 mM EDTA, 1% SDS). Incubate at 65℃ for 15 min., vortex shock every 4 min. Spin to remove all beads and incubate the supernatant at 65℃ for 16–24 h. Add RNase A to the sample and incubate at 37 oC for 2 h. Add Proteinase K and incubate at 55℃ for 30 min. Gel recycling kit for recovering DNA fragments. The final samples were detected by qPCR. CHIP qPCR primer sequence were as follows. Site1: forward, 5’-TCTATTTGAATTTATTATAT-3’, reverse, 5’-CAAGGGCATCCTTGTCATAA-3’; Site2: forward, 5’-GCCCAAGACGTGAATAATTT-3’, reverse, 5’-CTCCAAGACCTCCAGTGGAT; Site3: forward, 5’-TGTGCTCCCTGTGGATAAGG-3’, reverse, 5’-AGTGATCTCCCCAGGGCTCA; Site4: forward, 5’-GAGGCTTCTCTTAACCCTTC-3’, reverse, 5’-ACCTCCTATGGTTGTTGGAA.

Cell culture

HUH7 and HepG2 cell lines were cultured in DMEM with 10% FBS and 1% Penicillin streptomycin. Environment with 5% CO2 and hold on 37 ℃. Unless special note, most experiments of Smad2/3/4 complex activation were needed to add TGF-β1, the TGF-β1 concentration was 100-200PM.

Results

TAT expression is related with Smad2 and Smad3 in HCC

In our research, we used the GEPIA database to analyze the expression levels of TAT in HCC patients. The results showed that TAT was differentially expressed in these two groups (Fig. 1A). Subsequently, a univariate COX prognostic analysis was performed, and TAT gene was identified as having a significant impact on survival prognosis in HCC, indicating that high expression of the TAT gene is associated with better survival prognosis (Fig. 1B). In addition, ROC curves were generated for 1, 3, and 5 years (Fig. 1C). Our data also showed that low mRNA expression of TAT in HCC samples was significantly associated with mild clinical stage and pathological grade (Fig. 1D, E). Furthermore, the mRNA levels of TAT were down-regulated in liver cancer tissues compared with paracancerous (Fig. 1F). These results suggest that TAT may play an inhibitory role in HCC progression. Previous research also has reported that mutation of TAT can advance HCC progression [31]. However, the regulatory mechanism of TAT in HCC is unknown. In our research, we observed a positive correlation between TAT mRNA expression and Smad2 and Smad3 in clinical HCC tissues (Fig. 1G, H). Taken together, our results indicate a tumor suppressive role of TAT in HCC progression, and a regulatory role of the TGF-β pathway in TAT expression.

Fig. 1
figure 1

The mRNA level of TAT is positiv with Smad2 and Smad3. A Verification of the mRNA expression levels of TAT. Red represents tumor tissue, black represents normal tissue. B RFS and univariate COX analysis of TAT. C The ROC curve of TAT in HCC. D Expression of TAT in LIHC based on tumor grade. E Expression of TAT in LIHC based on individual cancer stages. F Expression level of TAT in HCC tissues and paracancerous n = 28. G–H The mRNA expression level relationship of TAT and Smad2, Smad3 in HCC tissues, n = 20. P < 0.05, *; P < 0.01,**; P < 0.001, ***

Full size image

TAT expression is regulated by Smad2/3/4 complex in HCC

When TGF-β signaling is activated, Smad2/3 and Smad4 assemble into the Smad2/3/4 complex, which then translocates to the nucleus to regulate target gene expression [10]. In the aforementioned study, we observed a positive correlation between TAT expression and Smad2 and Smad3. Based on these findings, we postulated that the Smad2/3/4 complex might play a regulatory role in TAT expression in HCC cell lines. To further investigate this relationship, we successfully downregulated Smad2 using shRNA in HUH7 and HepG2 cell lines. Additionally, we overexpressed Smad2 in these cell lines (Supplementary Fig. S1A-D). QPCR and Western Blot analysis showed that knockdown of Smad2 downregulated the mRNA and protein expression of TAT in HUH7 and HepG2 cell lines (Fig. 2A–D). Further, we depressed and overexpressed Smad3 and Smad4, respectively (Supplementary Fig. S1E-L). The results showed that, the same as Smad2, Smad3 and Smad4 could also regulate TAT expression at both mRNA and protein level in HUH7 and HepG2 cell lines (Fig. 2E–L). These results suggest that TAT expression is regulated by Smad2/3/4 complex in hepatoma cells.

Fig. 2
figure 2

Smad2/3 complex upregulation TAT in HCC cell lines. A–B Relative mRNA and protein levels of TAT were detected by qPCR and western blot analysis in HUH7 which knockdown (A) or overexpress (B) Smad2. C–D Relative mRNA and protein levels of TAT were detected by qPCR and western blot analysis in HepG2 cells which knockdown (C) or overexpress (D) Smad2. E–F Relative mRNA and protein levels of TAT were detected by qPCR and western blot analysis in and HUH7 cells which knockdown (E) or overexpress (F) Smad3. G–H Relative mRNA and protein levels of TAT were detected by qPCR and western blot analysis in HepG2 cells which knockdown (G) or overexpress (H) Smad3. I–J Relative mRNA and protein levels of TAT were detected by qPCR and western blot analysis in HUH7 cells which knockdown (I) or overexpress (J) Smad4. K–L Relative mRNA and protein levels of TAT were detected by qPCR and western blot analysis in HepG2 cells which knockdown (K) or overexpress (L) Smad4. 3μg and 5 μg is represented the quality of overexpression vector in each hole of 6-Wells plats. TGF-β1 (150 pM) was added in medium to activate Smads. P < 0.05, *; P < 0.01,**; P < 0.001,***; P < 0.0001, ****

Full size image

Smad2/3/4 complex undergoes liquid liquid phase separation

Smad2/3 and Smad4 assemble into a complex and translocate to the nucleus to regulate target gene expression when TGF-β signaling is activated [10]. Previous studies have shown that transcription factors undergo phase separation to regulate gene expression, and proteins that are prone to this process contain specific domains [15]. In particular, disorder sequences and PrLD domains are important for phase separation [17]. We analyzed the sequence characteristics of Smad2, Smad3, and Smad4, and found that Smad2 and Smad3 had little disorder sequence and no PrLD domain, while Smad4 had a large amount of disorder sequence and a PrLD domain (Fig. 3A). These findings suggest that the Smad2/3/4 complex may undergo LLPS during gene regulation, and that Smad4 may drive this process.

Fig. 3
figure 3

Liquid liquid phase separation of Smad2/3/4 complex. A Distribution of disorder and PrLD domain in Smad2, Smad3, Smad4. B Phase separation of Smad4 in vitro at different concentrations (from 10 to 40 µM in PBS). C Phase separation of Smad4 (30 µM) in vitro at different temperatures (37 ℃ and 4 ℃, 1 × PBS). D Phase separation of Smad4 (30 µM) in vitro at different NaCl concentrations (NaCl concentration 150, 300, 500, and 800 mM). E Smad4 undergo phase separation in HUH7 cells, TGF-β1 (10 ng/ml) treated cells for at least 12 h. TGF-β1 (200 pM) was added in medium to activate Smads. F Verified the liquid character of Smad4 droplets by Fluorescence recovery after photobleaching (FRAP). G Mixed Smad2, Smad3, Smad4 solution undergo LLPS in vitro

Full size image

Further, we purified Smad4 (Tagged with EGFP) protein using E. coli. We observed that Smad4 formed droplets in vitro (Fig. 3B). The formation of these droplets was affected by temperature, indicating that this was an example of a lower critical solution temperature phase diagram (Fig. 3C). NaCl concentration also influenced the formation of the droplets, suggesting that LLPS was driven by electrostatic interactions between the PrLD and disorder sequence (Fig. 3D). In vivo, we detected the formation of Smad4 liquid droplets form in HUH7 cells (Fig. 3E). To verify the liquid nature of these droplets, we conducted an experiment using fluorescent recovery after photobleaching (FRAP). The FRAP results revealed that the droplets exhibited rapid fluorescence recovery following bleaching (Fig. 3F), indicating that these droplets possessed liquid characteristics and indicating that Smad4 underwent liquid–liquid phase separation (LLPS). Additionally, we purified Smad2 and Smad3 using E. coli and found that the mixed Smad2/3/4 complex underwent phase separation to form liquid droplets in vitro (Fig. 3G). Collectively, these findings indicate that the Smad2/3/4 complex undergoes liquid–liquid phase separation in Hepatoma cells. Previous studies have established that the Smad2/3/4 complex regulates target gene expression [10], and that LLPS of transcription factors is necessary for gene expression [15]. Our research has found that the Smad2/3/4 complex undergoes phase separation, we believe that it also undergoes phase separation during transcription activity.

Smad2/3/4 complex binds to the TAT gene promotor site

Previous studies showed that Smad2/3/4 complex could bind to target gene promoter and increase promoter activity [32]. In our research, we used bioinformatics analysis found that Smad2/3/4 complex might bind to the transcriptional sites of TAT (Fig. 4A), suggesting that Smad2/3/4 complex can regulate the expression of TAT.

Fig. 4
figure 4

CHIP qPCR showed that Smad2/3 complex could bind to transcriptional regulatory regions of TAT. A Predicted the binding site of Smad2/3/4 complex in TAT transcriptional regulatory region. B–C CHIP qPCR analysis the binding sites of Smad2 in HUH7 (B) and HepG2 (C) cells. D–E CHIP qPCR analysis the binding sites of Smad3 in HUH7 (D) and HepG2 (E) cells. F–G CHIP qPCR analysis the binding sites of Smad4 in HUH7 (F) and HepG2 (G) cells. TGF-β1 (200 pM) was added in medium to activate Smads. P < 0.05, *; P < 0.01,**; P < 0.001,***; P < 0.0001, ****

Full size image

We used antibodies against Smad2, Smad3, and Smad4 to conduct chromatin immunoprecipitation (CHIP) experiments and qPCR to identify potential binding sites. The results indicated that the location between -1182 to -1032 is the key binding site of Smad2/3/4 complex in HUH7 and HepG2 cell lines (Fig. 4B–G). Above all, these data shows that Smad2/3/4 complex can bind to the TAT gene promotor site and undergo LLPS to regulate TAT gene expression.

Smad2/3/4 complex regulate HCC progression through TAT

Previous study shows that mutation of TAT could promote HCC progression [31]. TGF-β signaling pathway could also affect tumor progress [10]. Our results showed that Smad2/3/4 could regulate the expression of TAT. We deduced that Smad2/3/4 could regulate HCC progress through TAT. To explore the relationship between TAT and Smad2/3/4 complex in HCC progression. We used CCK and clone formation assays to test the cell proliferation ability. The CCK assay results showed that Smad2/3/4 complex could inhibit hepatoma cell proliferation (Fig. 5A–C, Supplementary Fig. S2A-C). So as the clone formation assay results (Fig. 5D, Supplementary Fig. S2D). Overexpression of TAT could also inhibit HUH7 and HepG2 cell proliferation, downregulation of Smad2 could rescue the phenomenon, furthermore, the results of Smad3 and Smad4 were similar with Smad2 (Fig. 5E–G, Supplementary Fig. S2E-G). The tendency of clone formation assay results was the same as CCK assay results (Fig. 5H–J, Supplementary Fig. S2H-J).

Fig. 5
figure 5

Smad2/3/4 complex could regulate HCC cell proliferation through TAT. A–C CCK analysis showed that knock down Smad2 (A), Smad3 (B) and Smad4 (C) could promote HUH7 cells proliferation. D Colony formation analysis showed that knock down Smad2, Smad3 and Smad4 could promote HUH7 cells proliferation. E–G CCK analysis showed that overexpressing TAT could inhibit HUH7 cells proliferation and knock down Smad2 (E), Smad3 (F) and Smad4 (G) could induce a compensatory effect. H–J Colony formation analysis showed that overexpressing TAT could inhibit HUH7 cells proliferation and knock down Smad2 (H), Smad3 (I) and Smad4 (J) could induce a compensatory effect. 5μg is represented the quality of overexpression vector in each hole of 6-Wells plats. TGF-β1 (100 pM) was added in medium to activate Smads. P < 0.05, *; P < 0.01,**; P < 0.001,***; P < 0.0001, ****

Full size image

In nude mice tumor formation model, the tumor grew faster when breaking the Smad2/3/4 complex formation. We knocked down Smad2, Smad3 and Smad4, respectively. The tumor volume was obviously increased (Fig. 6A–F), so as the tumor weight (Fig. 6G–I). We use tumor tissues taken form the nude mice tumors to test the TAT expression level and tyrosine level. The results showed that knockdown Smad2, Smad3 or Smad4 could decrease the expression level of TAT (Fig. 6J–L). These results suggest that Smad2/3/4 complex regulates tumor formation directly through regulating TAT.

Fig. 6
figure 6

Knocking down Smad2, Smad3 and Smad4 could promote HCC progression. A Tumors from the nude mice to show the Smad2 effect on tumor progression. B Tumor growth curves of (A). C Tumors from the nude mice to show the Smad3 effect on tumor progression. D Tumor growth curves of (C). E Tumors from the nude mice to show the Smad4 effect on tumor progression. F Tumor growth curves of (D). G–I Tumor weight of each group, shSmad2 (G), shSmad3 (H), shSmad4 (I). J–L Tested TAT mRNA level of tumors from nude mice, shSmad2 (J), shSmad3 (K), shSmad4 (L). P < 0.05, *; P < 0.01,**; P < 0.001,***; P < 0.0001, ****

Full size image

Smad2/3/4 complex induces hepatoma cell apoptosis through regulating TAT

Previous study shows that TGF-β signaling pathway can regulate cell apoptosis by upregulating BIM, BMF, DAPK expression [10], and TAT induces hepatoma cell apoptosis by activating caspase-9 [31]. In our research, we found that Smad2/3/4 complex could undergo LLPS to regulate TAT expression. Probably, Smad2/3/4 complex could active caspase-9 through TAT to induce hepatoma cell apoptosis. We overexpressed Smad2, Smad3 and Smad4, respectively. Flow cytometry analysis showed that Smad2/3/4 complex could increase apoptosis of hepatoma cells (Fig. 7A–C, Supplementary Fig. S3A-C). Western blot results showed that, all three members could increase the expression of cleaved caspase-9 in hepatoma cell lines (Fig. 7D–F, Supplementary Fig. S3D-F). Further, flow cytometry analysis results showed that overexpression of TAT could increase apoptosis of hepatoma cells and knocking down Smad2 could create a compensatory effect to decrease hepatoma cell apoptosis. Similar phenomena were observed in Smad3 and Smad4 (Fig. 6G–I, Supplementary Fig. S3G-I). We discovered that overexpressed TAT could increase the expression of cleaved caspase-9, but knocking down Smad2 could decrease cleaved caspase-9 level in hepatoma cell lines, so as Smad3 and Smad4 (Fig. 7J–L, Supplementary Fig. S3J-L). All these results suggest that Smad2/3/4 complex could active caspase-9 and induce hepatoma cell apoptosis through regulating TAT.

Fig. 7
figure 7

Smad2/3/4 could active caspase-9 through TAT in HUH7 cells. A–C Flow cytometry analysis showed that upregulated Smad2 (A), Smad3 (B) and Smad4 (C) could induce HUH7 cell apoptosis. D–F Upregulated Smad2 (D), Smad3 (E) and Smad4 (F) could active caspase-9 in HUH7 cells. G–I Flow cytometry analysis showed that upregulated TAT could induce apoptosis, but knocking down Smad2 (G), Smad3 (H), Smad4 (I) could inhibit apoptosis in HUH7 cells. J–L Upregulated TAT could active caspase-9, but knocking down Smad2 (J), Smad3 (K), Smad4 (L) could inhibit the caspase-9 active in HUH7 cells. 3μg and 5μg is represented the quality of overexpression vector in each hole of 6-Wells plats. TGF-β1 (100 pM) was added in medium to activate Smads

Full size image

Taking together, our research explored that Smad2/3/4 complex could undergo LLPS and binds to TAT gene promotor site to upregulate TAT expression, which can active caspase-9 to induce hepatoma cell apoptosis (Fig. 8).

Fig. 8
figure 8

Working Model. The TGF-β signaling pathway is activated by TGF-β binding to TβRII, which recruits and phosphorylates TβRI, and then TβRI phosphorylates Smad2 and Smad3, which assemble heterodimeric and trimeric complexes with Smad4. Smad2/3/4 complexes translocate to the nucleus. In the nucleus, Smad2/3/4 complex could undergo LLPS to activate TAT transcription, then active caspase-9 to induce hepatoma cell apoptosis to inhibit HCC progression. The graph was created with BioRender.com

Full size image

Discussion

Numerous studies have shown that the accumulation of cellular and molecular aberrations can lead to the development of HCC, including abnormalities in epigenetics, transcriptome, proteome and metabolome [33]. Obviously, HCC has remarkable molecular heterogeneity including many genetic and protein-level changes. Therefore, the search for new targeted genes in HCC patients are expected to provide new directions to explore the mechanisms of HCC, as well as new drug targets.

TGF-β signaling pathway plays a dual role in cancer progress, not only inhibits tumor progress by inducing cell cycle arrest, but also induces tumor migration and stimulates epithelial to mesenchymal transition [10]. Activation of TGF signaling pathway dependent on receptor TGFβ receptors, but TGFβ receptors (TβR II and TβR I) behave very differently in HCC and other signaling pathway. TβR II mutation occurs in many cancers, such as colon, gastric, pulmonary, ovarian, esophageal, carcinomas [34]. TβR I and TβR II often down-regulated in lung, gastric, prostate, and bladder cancers, and TβR I promoter often methylated in gastric cancer [11]. TGFβ receptors also play significant roles in stromal cells in the tumor microenvironment. TGF-β showed immunosuppressive effects on both innate and adaptive immune cells [10]. The down expression and mutated of TβRII also fund in HCC [7, 8], but TβR II and TβR I also related with fibrogenesis and carcinogenesis (fibro-carcinogenesis) in HCC. During hepatitis virus–related chronic liver diseases, alterations additively shift hepatocytic Smad phospho-isoform signaling from tumor suppression to fibro-carcinogenesis, thereby accelerating liver fibrosis and increasing risk of HCC [35]. So, TGF-β signaling pathway showed complexity function in tumor progression. We supposed that Smad2/3/4 could regulate different gene expressions then regulate HCC progress. In our research, Smad2/3/4 complex played a suppression role in HCC through regulating TAT expression.

LLPS is a newly found phenomenon with a variety of possible functions, such as transcriptional or translational regulation [36,37,38], RNA metabolism [39], and signal transduction [40]. LLPS can locally concentrate molecules in condensates to activate reactions and signaling processes, increasing the local concentration of key enzymes or protein complexes to accelerate biochemical reactions [17]. Interestingly, we analysed the amino acid sequence characters of Smad2, Smad3 and Smad4. The data showed that Smad4 had large amounts of disorder sequence and PrLD domain, which could drive protein to undergo LLPS [36, 41, 42], suggesting that Smad4 could undergo phase separation. Further, we discovered Smad4 could form liquid droplets at different concentration, and the formation of liquid droplets could be affected by temperature and NaCl concentration. The mixed Smad2, Smad3 and Smad4 solution could also form liquid droplets. All these results showed that Smad2/3/4 complex could undergo phase separation. Previous studies show that Smad2, Smad3 and Smad4 are phosphorylated when TGF-β signaling pathway is activated [10]. So, Smad2/3/4 complex must stay on phosphorylation status when the complex translocates into the nucleus and regulates target gene expression. Phosphorylation and methylation are important for protein undergoing LLPS [43,44,45,46]. In our research, we used E. coli to express Smad2/3/4 recombinant protein. However, E. coli system could not express recombinant protein with phosphorylation. Therefore, we could not get the detailed information of the phosphorylation effect on Smad2/3/4 LLPS. We are trying to use the HEK293T cell to express Smad2/3/4 recombinant proteins with phosphorylation modification. This may give us more information about the Smad2/3/4 LLPS. Smad family members not only include Smad2, Smad3 and Smad4, but also contain Smad1, Smad5, Smad7, Smad8 and Smad6 [47]. We are also interested in whether these proteins can undergo LLPS.

Previous studies showed that transcription factor can undergo LLPS with mediator to activate gene expression [15, 16]. Our research found that Smad2/3/4 complex could undergo phase separation, so we believed that Smad2/3/4 complex underwent phase separation in transcription activity. We performed a series of experiments to find that Smad2/3/4 complex could regulate TAT expression then inhibit HCC progress. It is reported that Smad3 and Smad4 can bind directly to DNA(Smad2 can’t), and the affinity between Smad3/4 and DNA is relatively weak and need another transcription factor to regulate gene expression[48, 49]. We are also interested in whether other proteins take part in Smad2/3/4 complex undergoing LLPS. We conducted Smad3 and Smad4 CoIP experiment and mass spectrometry analysis (data not shown), hoped to get more information about this.

Studies have shown that activation of TAT in the tyrosine metabolic pathway influences the treatment resistance of glioblastoma core [50]. The TAT gene encodes the mitochondrial protein tyrosine aminotransferase present in liver, which breaks down tyrosine into p-hydroxyphenylpyruvate. Although aberrant expression of TAT in HCC has been shown to be associated with a poor prognosis [31], currently, there is little evidence on how tyrosine metabolism affects cancer progress. To find the cause of the low expression of TAT in HCC, we focused on the TGF-β/Smad2/3/4 signaling pathway, which also acted as a tumor suppressor in cancer [51, 52]. Our data connected TGF-β signaling pathway and TAT in HCC progress, which brought new insights in TGF-β signaling pathway function in HCC progress.

Above all, we found that Smad2/3/4 could undergo liquid–liquid phase separation to active TAT expression. We experimentally verified a significant link between TAT and Smad2/3/4 complex in HCC progress. In addition, we found that Smad2/3/4 complex could active caspase-9 to induce hepatoma cell apoptosis through regulating TAT. This result contributes to deeper understanding of the role of TGF-β signaling pathway in HCC progress. Meanwhile, it also brings new insights into the mechanism of hepatocellular carcinoma.

Conclusions

Our results showed that TAT showed low expression in clinical HCC samples. Notably, TAT was found to be a novel target gene of Smad2/3/4 complex, and Smad2/3/4 could undergo phase separation to active TAT gene expression. Smad2/3/4 activated caspase-9 through regulating TAT to induce hepatoma cell apoptosis. Our research suggested that inhibiting Smad2/3/4 LLPS might become a new strategy to inhibit HCC progress. Above all, we found that Smad2/3/4 complex could undergo liquid liquid phase separation to active TAT gene expression, and active caspase-9 to induce hepatoma cell apoptosis through regulating TAT to inhibit HCC progress.

Availability of data and materials

There no new data were created.

References

  1. Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin. 2022;72(1):7–33.

    Article  PubMed  Google Scholar 

  2. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49.

    Article  PubMed  Google Scholar 

  3. Grazzini G, Chiti G, Zantonelli G, Matteuzzi B, Pradella S, Miele V. Imaging in hepatocellular carcinoma: what’s New? Semin Ultrasound CT MR. 2023;44(3):145–61.

    Article  PubMed  Google Scholar 

  4. Couri T, Pillai A. Goals and targets for personalized therapy for HCC. Hep Intl. 2019;13(2):125–37.

    Article  Google Scholar 

  5. Prunier C, Baker D, ten Dijke P, Ritsma L. TGF-β family signaling pathways in cellular dormancy. Trends Cancer. 2019;5(1):66–78.

    Article  CAS  PubMed  Google Scholar 

  6. Lin TH, Shao YY, Chan SY, Huang CY, Hsu CH, Cheng AL. High serum transforming growth factor-β1 levels predict outcome in hepatocellular carcinoma patients treated with sorafenib. Clin Cancer Res. 2015;21(16):3678–84.

    Article  CAS  PubMed  Google Scholar 

  7. Yamazaki K, Masugi Y, Sakamoto M. Molecular pathogenesis of hepatocellular carcinoma: altering transforming growth factor-β signaling in hepatocarcinogenesis. Digest Dis. 2011;29(3):284–8.

    Article  Google Scholar 

  8. Dituri F, Mancarella S, Cigliano A, Chieti A, Giannelli G. TGF-β as multifaceted orchestrator in HCC progression: signaling, EMT, immune microenvironment, and novel therapeutic perspectives. Semin Liver Dis. 2019;39(1):53–69.

    Article  CAS  PubMed  Google Scholar 

  9. Peng DD, Fu MY, Wang MN, Wei YQ, Wei XW. Targeting TGF-β signal transduction for fibrosis and cancer therapy. Mol Cancer. 2022. https://doi.org/10.1186/s12943-022-01569-x.

    Article  PubMed  PubMed Central  Google Scholar 

  10. Colak S, ten Dijke P. Targeting TGF-beta signaling in cancer. Trends in cancer. 2017;3(1):56–71.

    Article  CAS  PubMed  Google Scholar 

  11. Massagué J. TGFβ in cancer. Cell. 2008;134(2):215–30.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Heldin CH, Landstrom M, Moustakas A. Mechanism of TGF-beta signaling to growth arrest, apoptosis, and epithelial-mesenchymal transition. Curr Opin Cell Biol. 2009;21(2):166–76.

    Article  CAS  PubMed  Google Scholar 

  13. Yang L, Pang Y, Moses HL. TGF-beta and immune cells: an important regulatory axis in the tumor microenvironment and progression. Trends Immunol. 2010;31(6):220–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Ikushima H, Miyazono K. TGFbeta signalling: a complex web in cancer progression. Nat Rev Cancer. 2010;10(6):415–24.

    Article  CAS  PubMed  Google Scholar 

  15. Boija A, Klein IA, Sabari BR, Dall’Agnese A, Coffey EL, Zamudio AV, Li CH, Shrinivas K, Manteiga JC, Hannett NM, et al. Transcription factors activate genes through the phase-separation capacity of their activation domains. Cell. 2018;175(7):1842–55.

    Article  CAS  PubMed  Google Scholar 

  16. Sabari BR, Dall’Agnese A, Boija A, Klein IA, Coffey EL, Shrinivas K, Abraham BJ, Hannett NM, Zamudio AV, Manteiga JC, et al. Coactivator condensation at super-enhancers links phase separation and gene control. Science. 2018. https://doi.org/10.1126/science.aar3958.

    Article  PubMed  PubMed Central  Google Scholar 

  17. Alberti S, Gladfelter A, Mittag T. Considerations and challenges in studying liquid-liquid phase separation and biomolecular condensates. Cell. 2019;176(3):419–34.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Delarue M, Brittingham GP, Pfeffer S, Surovtsev IV, Pinglay S, Kennedy KJ, Schaffer M, Gutierrez JI, Sang D, Poterewicz G, et al. mTORC1 controls phase separation and the biophysical properties of the cytoplasm by tuning crowding. Cell. 2018;174(2):338–49.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Fang X, Wang L, Ishikawa R, Li Y, Fiedler M, Liu F, Calder G, Rowan B, Weigel D, Li P, et al. Arabidopsis FLL2 promotes liquid-liquid phase separation of polyadenylation complexes. Nature. 2019;569(7755):265–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. McQuilken M, Mehta SB, Verma A, Harris G, Oldenbourg R, Gladfelter AS. Polarized fluorescence microscopy to study cytoskeleton assembly and organization in live cells. Curr Protoc Cell Biol. 2015. https://doi.org/10.1002/0471143030.cb0429s67.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Li J, Chen K, Dong X, Xu Y, Sun Q, Wang H, Chen Z, Liu C, Liu R, Yang Z, et al. YTHDF1 promotes mRNA degradation via YTHDF1-AGO2 interaction and phase separation. Cell Prolif. 2022;55(1):e13157.

    Article  CAS  PubMed  Google Scholar 

  22. Li J, Cui P, Sun Q, Du Z, Chen Z, Li Z, Liu C, Cao Y, Yang Z, Liu R, et al. PSPC1 regulates CHK1 phosphorylation through phase separation and participates in mouse oocyte maturation. Acta Biochim Biophys Sin. 2021;53(11):1527–37.

    Article  CAS  PubMed  Google Scholar 

  23. Mensah MA, Niskanen H, Magalhaes AP, Basu S, Kircher M, Sczakiel HL, Reiter AMV, Elsner J, Meinecke P, Biskup S, et al. Aberrant phase separation and nucleolar dysfunction in rare genetic diseases. Nature. 2023;614(7948):564–71.

    CAS  PubMed  PubMed Central  Google Scholar 

  24. Liu Q, Li J, Zhang W, Xiao C, Zhang S, Nian C, Li J, Su D, Chen L, Zhao Q, et al. Glycogen accumulation and phase separation drives liver tumor initiation. Cell. 2021;184(22):5559–76.

    Article  CAS  PubMed  Google Scholar 

  25. Meng J, Han J, Wang X, Wu T, Zhang H, An H, Qin L, Sun Y, Zhong W, Yang C, et al. Twist1-YY1-p300 complex promotes the malignant progression of HCC through activation of miR-9 by forming phase-separated condensates at super-enhancers and relieved by metformin. Pharmacol Res. 2023;188:106661.

    Article  CAS  PubMed  Google Scholar 

  26. Lai HS, Lee JC, Lee PH, Wang ST, Chen WJ. Plasma free amino acid profile in cancer patients. Semin Cancer Biol. 2005;15(4):267–76.

    Article  CAS  PubMed  Google Scholar 

  27. Schiff M, Broue P, Chabrol B, De Laet C, Habes D, Mention K, Sarles J, Spraul A, Valayannopoulos V, Ogier de Baulny H, et al. Heterogeneity of follow-up procedures in French and Belgian patients with treated hereditary tyrosinemia type 1: results of a questionnaire and proposed guidelines. J Inherit Metab Dis. 2012;35(5):823–9.

    Article  PubMed  Google Scholar 

  28. Kim SZ, Kupke KG, Ierardi-Curto L, Holme E, Greter J, Tanguay RM, Poudrier J, D’Astous M, Lettre F, Hahn SH, et al. Hepatocellular carcinoma despite long-term survival in chronic tyrosinaemia I. J Inherit Metab Dis. 2000;23(8):791–804.

    Article  CAS  PubMed  Google Scholar 

  29. Watanabe A, Higashi T, Sakata T, Nagashima H. Serum amino acid levels in patients with hepatocellular carcinoma. Cancer. 1984;54(9):1875–82.

    Article  CAS  PubMed  Google Scholar 

  30. Baumann U, Duhme V, Auth MK, McKiernan PJ, Holme E. Lectin-reactive alpha-fetoprotein in patients with tyrosinemia type I and hepatocellular carcinoma. J Pediatr Gastroenterol Nutr. 2006;43(1):77–82.

    Article  CAS  PubMed  Google Scholar 

  31. Fu L, Dong SS, Xie YW, Tai LS, Chen L, Kong KL, Man K, Xie D, Li Y, Cheng Y, et al. Down-regulation of tyrosine aminotransferase at a frequently deleted region 16q22 contributes to the pathogenesis of hepatocellular carcinoma. Hepatology. 2010;51(5):1624–34.

    Article  CAS  PubMed  Google Scholar 

  32. Samanta D, Datta PK. Alterations in the Smad pathway in human cancers. Front Biosci-Landmrk. 2012;17:1281–93.

    Article  CAS  Google Scholar 

  33. Hanahan D. Hallmarks of cancer: new dimensions. Cancer Discov. 2022;12(1):31–46.

    Article  CAS  PubMed  Google Scholar 

  34. Levy L, Hill CS. Alterations in components of the TGF-β superfamily signaling pathways in human cancer. Cytokine Growth F R. 2006;17(1–2):41–58.

    Article  CAS  Google Scholar 

  35. Matsuzaki K, Seki T, Okazaki K: TGF-β signal shifting between tumor suppression and fibro-carcinogenesis in human chronic liver diseases. J Gastroenterol. 2014;49(6):971–81.

    Article  PubMed  PubMed Central  Google Scholar 

  36. Franzmann TM, Alberti S: Prion-like low-complexity sequences: Key regulators of protein solubility and phase behavior. J Biol Chem 2019;294(18):7128–36.

  37. Kroschwald S, Munder MC, Maharana S, Franzmann TM, Richter D, Ruer M, Hyman AA, Alberti S: Different Material States of Pub1 Condensates Define Distinct Modes of Stress Adaptation and Recovery. Cell Rep 2018;23(11):3327–39.

  38. Riback JA, Katanski CD, Kear-Scott JL, Pilipenko EV, Rojek AE, Sosnick TR, Drummond DA: Stress-Triggered Phase Separation Is an Adaptive, Evolutionarily Tuned Response. Cell. 2017;168(6):1028–40 e1019.

  39. Sheu-Gruttadauria J, MacRae IJ: Phase Transitions in the Assembly and Function of Human miRISC. Cell. 2018;173(4):946–57 e916.

  40. Su X, Ditlev JA, Hui E, Xing W, Banjade S, Okrut J, King DS, Taunton J, Rosen MK, Vale RD: Phase separation of signaling molecules promotes T cell receptor signal transduction. Science. 2016;352(6285):595–9.

  41. Elbaum-Garfinkle S, Kim Y, Szczepaniak K, Chen CC, Eckmann CR, Myong S, Brangwynne CP: The disordered P granule protein LAF-1 drives phase separation into droplets with tunable viscosity and dynamics. Proc Nat Acad Sci United States of Amer. 2015;112(23):7189–94.

  42. Nott TJ, Petsalaki E, Farber P, Jervis D, Fussner E, Plochowietz A, Craggs TD, Bazett-Jones DP, Pawson T, Forman-Kay JD et al: Phase transition of a disordered nuage protein generates environmentally responsive membraneless organelles. Molec Cell. 2015;57(5):936–47.

  43. Hofweber M, Hutten S, Bourgeois B, Spreitzer E, Niedner-Boblenz A, Schifferer M, Ruepp MD, Simons M, Niessing D, Madl T et al: Phase Separation of FUS Is Suppressed by Its Nuclear Import Receptor and Arginine Methylation. Cell. 2018;173(3):706–9 e713.

  44. Monahan Z, Ryan VH, Janke AM, Burke KA, Rhoads SN, Zerze GH, O'Meally R, Dignon GL, Conicella AE, Zheng W et al: Phosphorylation of the FUS low-complexity domain disrupts phase separation, aggregation, and toxicity. EMBO J. 2017;36(20):2951–67.

  45. Qamar S, Wang G, Randle SJ, Ruggeri FS, Varela JA, Lin JQ, Phillips EC, Miyashita A, Williams D, Strohl F et al: FUS Phase Separation Is Modulated by a Molecular Chaperone and Methylation of Arginine Cation-pi Interactions. Cell. 2018;173(3):720–34 e715.

  46. Saito M, Hess D, Eglinger J, Fritsch AW, Kreysing M, Weinert BT, Choudhary C, Matthias P: Acetylation of intrinsically disordered regions regulates phase separation. Nat Chem Biol 2019;15(1):51–61.

  47. Zhang Y, Alexander PB, Wang XF: TGF-beta Family Signaling in the Control of Cell Proliferation and Survival. Cold Spring Harbor Perspect Biol 2017;9(4):a022145.

  48. Heldin CH, Moustakas A: Role of Smads in TGFbeta signaling. Cell Tissue Res 2012;347(1):21–36.

  49. Schmierer B, Hill CS: TGFbeta-SMAD signal transduction: molecular specificity and functional flexibility. Nat Rev Molec Cell Biol 2007;8(12):970–82.

  50. Yamashita D, Bernstock JD, Elsayed G, Sadahiro H, Mohyeldin A, Chagoya G, Ilyas A, Mooney J, Estevez-Ordonez D, Yamaguchi S et al: Targeting glioma-initiating cells via the tyrosine metabolic pathway. J Neurosurg 2021;134(3):721–32.

  51. Drabsch Y, ten Dijke P: TGF-beta signalling and its role in cancer progression and metastasis. Cancer Metastasis Rev 2012;31(3–4):553–68.

  52. Akhurst RJ, Derynck R: TGF-beta signaling in cancer--a double-edged sword. Trends Cell Biol 2001;11(11):S44–51.

Download references

Acknowledgements

We thanks the Postdoctoral Station of Medical Aspects of Specific Environments, The Third Xiangya Hospital, Central South University providing lab and funding support.

Funding

Pengfei Rong supported by the National Natural Science Foundation of China (82071986), the Science and Technology Project of Hunan Province (2021RC4017), the Furong Scholars Programme of Hunan Province (2022), and the Wisdom Accumulation and Talent Cultivation Project of the Third Xiangya Hospital of Central South University (2020), the Key Research and Development Program of Hunan Province (2022SK2025); The Science and Technology Project of Hunan Province (2023JJ40882) to Jiong Li; The National Natural Science Foundation of China (Grant No: 81971721) to Wei Wang; The National Natural Science Foundation of China (No. 31800688), the Foundation of Liaoning Educational Committee of China (No. JYTMS20230765, No. LQN202011), the Shenyang Youth Science and Technology Innovation Project (No. RC220177), the Screening of small-molecule tumor suppression compounds project (No. SDUZHHT〔2022〕2448) to Zhe Yang.

Author information

Authors and Affiliations

  1. Department of Radiology, The Third Xiangya Hospital, Central South University, Changsha, Hunan, China

    Jiong Li, Yaning Zhu, Hongpei Tan, Xiaoqian Ma, Yuqian Dong, Zhenhu He, Zhen Wang, Qin Liu, Shanhu Yao, Cejun Yang, Min Yang, Lu Cao, Juan Zhang, Wei Li, Wei Wang & Pengfei Rong

  2. Postdoctoral Station of Medical Aspects of Specific Environments, The Third Xiangya Hospital, Central South University, Changsha, Hunan, China

    Jiong Li

  3. College of Life Science, Liaoning University, Shenyang, China

    Wendi Wang, Zhengkang Qiao, Haoyue Jiang, Xinyue Chang & Zhe Yang

  4. Shenyang Key Laboratory of Chronic Disease Occurrence and Nutrition Intervention, College of Life Sciences, Liaoning University, Shenyang, 110036, China

    Zhe Yang

  5. Engineering and Technology Research Center for Xenotransplantation of Human Province, Changsha, China

    Sang Li

Authors
  1. Jiong Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Wendi Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Sang Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Zhengkang Qiao
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Haoyue Jiang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Xinyue Chang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Yaning Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Hongpei Tan
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Xiaoqian Ma
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Yuqian Dong
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Zhenhu He
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Zhen Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Qin Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  14. Shanhu Yao
    View author publications

    You can also search for this author in PubMed Google Scholar

  15. Cejun Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  16. Min Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  17. Lu Cao
    View author publications

    You can also search for this author in PubMed Google Scholar

  18. Juan Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  19. Wei Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  20. Wei Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  21. Zhe Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  22. Pengfei Rong
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

P, R and Z, Y designed the project and wrote the manuscript. J, L; W, W; S, L; C, Y; Y, Z; carried out most of the experiments. Z, Q; X, C and H, J performed most of the bioinformatics analysis. H, T; X, M; Y, D; Z, H; Z, W; Q, L; S, Y; M, Y; L, C; J, Z; W, L; W, W participated in writing the manuscript. All authors have read and agreed to the published version of the manuscript. All authors reviewed the manuscript.

Corresponding authors

Correspondence to Zhe Yang or Pengfei Rong.

Ethics declarations

Ethics approval and consent to participate

Research performed mouse material and patient tissues, The Inspection of the Institutional Animal Care and Use Committee of The Third Xiangya Hospital, Central South University approved this study (LLSC(CLA)2019-006 and 23292).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

12935_2024_3353_MOESM1_ESM.tif

Supplementary material 1: Figure S1. Regulated Smad2, Smad3 and Smad4 expression level in HCC cell lines. (A) ShRNA knockdown efficiency of Smad2 was examined by qPCR and western blot analysis in HUH7 cells. (B) qPCR and western blot analysis showed the overexpressed of Smad2 by eukaryotic expression plasmid in HUH7 cells. (C-D) The expression level of Smad2 was examined by qPCR and western blot analysis in HepG2 cells. (E-F) The expression level of Smad3 was examined by qPCR and western blot analysis in HUH7 cells. (G-H) The expression level of Smad3 was examined by qPCR and western blot analysis in HepG2 cells. (I-J) The expression level of Smad4 was examined by qPCR and western blot analysis in HUH7 cells. (K-L) The expression level of Smad4 was examined by qPCR and western blot analysis in HepG2 cells. 3μg and 5μg is represented the quality of overexpression vector in each hole of 6-Wells plats. P<0.05, *; P<0.01,**; P<0.001,***; P<0.0001, ****. TGF-β1 (150 pM) was added in medium to activate Smads.

12935_2024_3353_MOESM2_ESM.tif

Supplementary material 2: Figure S2. Smad2/3/4 complex could inhibit HCC cell proliferation through TAT in HepG2 cells. (A-C) CCK analysis showed that knock down Smad2 (A), Smad3 (B) and Smad4 (C) could promote HepG2 cells proliferation. (D) Colony formation analysis showed that knock down Smad2, Smad3 and Smad4 could promote HepG2 cells proliferation. (E-G) CCK analysis showed that overexpressing TAT could inhibit HepG2 cells proliferation and knock down Smad2 (E), Smad3 (F) and Smad4 (G) could induce a compensatory effect. (H-J) Colony formation analysis showed that overexpressing TAT could inhibit HepG2 cells proliferation and knock down Smad2 (H), Smad3 (I) and Smad4 (J) could induce a compensatory effect. 5μg is represented the quality of overexpression vector in each hole of 6-Wells plats. P<0.05, *; P<0.01,**; P<0.001,***; P<0.0001, ****. TGF-β1 (150 pM) was added in medium to activate Smads.

12935_2024_3353_MOESM3_ESM.tif

Supplementary material 3: Figure S3. Smad2/3/4 could active caspase-9 through TAT in HepG2 cells. (A-C) Flow cytometry analysis showed that upregulated Smad2 (A), Smad3 (B) and Smad4 (C) could induce HepG2 cell apoptosis. (D-F) Upregulated Smad2 (D), Smad3 (E) and Smad4 (F) could active caspase-9 in HepG2 cells. (G-I) Flow cytometry analysis showed that upregulated TAT could induce apoptosis, but knocking down Smad2 (G), Smad3 (H), Smad4 (I) could inhibit apoptosis in HepG2 cells. (J-L) Upregulated TAT could active caspase-9, but knocking down Smad2 (J), Smad3 (K), Smad4 (L) could inhibit the caspase-9 active in HepG2 cells. 3μg and 5μg is represented the quality of overexpression vector in each hole of 6-Wells plats. TGF-β1 (150 pM) was added in medium to activate Smads.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Li, J., Wang, W., Li, S. et al. Smad2/3/4 complex could undergo liquid liquid phase separation and induce apoptosis through TAT in hepatocellular carcinoma. Cancer Cell Int 24, 176 (2024). https://doi.org/10.1186/s12935-024-03353-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12935-024-03353-x

Keywords

Cancer Cell International

ISSN: 1475-2867

Contact us