Cell culture and transfection
Breast cancer cell lines were procured from Animal Type Cell Culture (ATCC) and National Centre for Cell Science, Pune (NCCS). Two models of breast cancer cells having different metastatic potential that is MDA-MB-231 and MCF-7 cells were grown in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Invitrogen, USA) supplemented with 1% penicillin, streptomycin (PS) antibiotic solution (Gibco, Invitrogen, USA) and 10%(v/v) heat-inactivated fetal bovine serum (FBS) (Gibco, Invitrogen, USA) in CO2 incubator at 37 °C [30]. Cells were treated with 50 nM DOX and transfected with 20 nM of mimic and antisense of let-7a using Lipofectamine 2000 (Invitrogen) [37].
Generation of ρ0 cells
ρ0 cells are the cells that have depleted mtDNA generated by exposing the cells with EtBr in the presence of uridine. MCF-7 and MDA-MB-231 cells were seeded in culture medium containing EtBr (50 µg/ml) supplemented with uridine (50 mg/ml) for 15 days. After completion of the incubation period, cells were harvested and processed as per the experimental requirement [3].
Mitochondria isolation and purity analysis
After completion of subsequent time point of cell culture and treated cells were harvested, and mitochondria were isolated using Mitochondria Isolation Kit from Cultured Cells (ThermoScientific™). Briefly, 5*106 cells were harvested in mitochondrial isolation buffer A followed by mitochondrial isolation reagent B. Mixture was then centrifuged at 700g for 10 min at 4 °C. After fractionation, the supernatant containing cytoplasmic fraction was stored and pellet containing mitochondrial fraction were washed with reagent C followed by RNAse treatment (10 mg/ml; 10 µl per 5 million cells) for 30 min at RT and then used for different parts of the experiment. The purity of the mitochondrial fraction was analyzed by Immunoblotting and RT-PCR for genes associated with mtDNA.
RNA isolation and sequencing
Cellular and mitochondrial RNA was extracted using TRIZOL reagent (Invitrogen) followed by purity analysis and RNA quantification by Nanodrop™ 2000 Spectrophotometer [37]. After quantification, 5 µg of each RNA sample were processed for, small RNA sequencing using Ion Torrent Proton™. (Thermofisher).
Reverse transcription and quantitative real-time PCR
To determine the relative expression of different genes, RT-PCR/qPCR was performed. For miRNA specific quantification, MMLV Reverse transcriptase was used to reverse transcribe 200 ng of RNA. For RT-qPCR, the reaction mixture was prepared as following; 200 nM of forward and reverse primers were added, followed by 2 µl of diluted cDNA, 5 µl of 2X SYBR green master mix and then nuclease-free water was added to make a final reaction mixture of 10 µl. Initially, the reaction was initiated at 95 °C for 10 min, denaturation for 10 s followed by annealing and extension at 58 °C and 72 °C, respectively. The relative expression of the mitomiRs was normalized by U6 expression and calculated by the threshold cycle method (2−^^CT) [38]. Primers used for miRNAs, mitochondrial and nuclear specific genes are provided below:
Primer | Sequence |
|---|
Let-7a-Forward | TATACAACCTACTACCTCA |
Let-7a-mimic | UGAGGUAGUAGGUUGUAUAGUU |
Let-7a-antisense | ATATGTTGGATGATGGAGT |
Let-7a-Forward | UGAGGUAGUAGGUUGUAUAGUU(Btn) |
Let-7b-Forward | CATACAACCTACTACCTCA |
Let-7b-cDNA | GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACCA |
miR-494-cDNA | GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAGAGA |
miR-494-Forward | GTAGGTTGTCCGTGTTGTC |
miR-609-cDNA | GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGACCCAACAGAGA |
miR-609-Forward | GTTGGAGGGTGTTTCTTCTC |
ND4-Forward | TTTTTAACCAAATCAACAACAACC |
ND4-Reverse | TGTGAGGGGTAGGAGTCAGG |
ND1-Forward | ATGGCCAACCTCCTACTCCT |
ND1-Reverse | GGGCCTTTGCGTAGTTGTAT |
β-Actin-Forward | AGAGCTACGAGCTGCCTGAC |
β-Actin-Reverse | AGCACTGTGTTGGCGTACAG |
U6-Forward | GCTTCGGCAGCACATATACTAA |
U6-Reverse | AACGCTTCACGAATTTGCGT |
Proteomic analysis
The differential expression of proteins expressed in cells was determined using mass spectrometric (MS) based proteomics. Mitochondria were isolated from the cells transfected with mimic and antisense of let-7a. The mitochondrial pellet was lysed in lysis buffer containing 6 M guanidium chloride, Tris (pH-8.5) − 0.1 M, and kept at 90 °C for 10 min. The lysate was then exposed to sonication for breaking nucleic acid and reducing the viscosity of shiny material and again kept at 90 °C for 10 min. Centrifugation was carried out at 15000K for 20 min at room temperature, and the supernatant was collected and then, protein concentration was estimated using Bradford reagent. Approximately 2 mg/ml of lysate was further processed for MS analysis. MS analysis of peptide mixtures was performed using EASY-nLC 1000 system (ThermoFisher Scientific) coupled to Thermo Fisher-QExactive equipped with nanoelectrospray ion source. 1.0 µg of the peptide mixture was resolved using a 25 cm PicoFrit column filled with 1.8 µm of C18-resin. The peptides were loaded with buffer A and eluted with a 0–40% gradient of buffer B (95% acetonitrile, 0.1% formic acid) at a flow rate of 300 nl/min for 10 min and MS data was acquired.
Biotinylated pulldown assay
Biotinylated pull-down assay was performed using biotin-labeled let-7a. MCF-7 cells were harvested and the cellular lysate was prepared using lysis buffer (Tris pH 7.4-50 mM, NP40-1%, NaCl-150 mM, DTT-1 mM, and PI cocktail). Approximately 300 µg of lysate was incubated with biotinylated let-7a and magnetic streptavidin beads (Sigma-Aldrich) in RNA protein binding buffer (Tris pH 7.8–0.2 M, NaCl-0.5 M, MgCl2- 20 mM and Tween20-1%) at 4 °C. In total, the mixture was incubated for 2 h to explore the expected interaction of let-7a with the mitochondrial genome.
Biotinylated pull-down assay was also performed after transiently transfecting MCF-7 cells with biotinylated let-7a (20 nM) for 24 h, and then lysate was prepared using the above-described lysis buffer. After completion of the incubation time, a magnetic frame was used to remove the supernatant, and magnetic beads containing complex was collected for RNA extraction, and RT-PCR was performed to assess the binding of let-7a with the target [25].
RNA immunoprecipitation assay
RNA immunoprecipitation was performed using Dynabeads Protein A (Novex, Life Technologies) and anti-AGO2 antibody (Sigma). Briefly, after removing media from the cultured MCF-7 cells, cells were washed with 1× PBS and then crosslinked using 2% paraformaldehyde for 5 min. Crosslinking was stopped by adding 125 mM glycine and lysed using lysing buffer (Tris pH-50 mM, NaCl-150 mM, MgCl2-20 mM and NP40-0.8%, glycerol-5%, EDTA-10 mM and SDS-0.5%) with frequent tapping on ice for 45 min and then centrifuged at 10,000 rpm for 5 min at 4 °C. Approximately 250 µg of lysate was incubated with an anti-AGO2 antibody with continuous mixing at 4 °C followed by the addition of Dynabeads Protein A for another 1 h. A magnetic frame was applied to remove the supernatant, and beads containing immunocomplex were washed with lysis buffer. Reverse crosslinking was achieved by adding 5 µl of 5 M NaCl per 100 µl solution at 65 °C then RNA was isolated using the TRIzol method, and then RT-PCR was performed for analyzing the expression of ND4 [39].
The expression of ND4 was assessed to confirm its interaction with AGO2.
Luciferase assay
The pMIR-REPORT miRNA Expression Reporter Vector System was used to analyze the interaction of let-7a with the target sequence (MT-ND4) [40]. Let-7a targeting sequence was commercially synthesized from Sigma and cloned into HindIII restrict endonuclease of pMIR Report vector. Vector was co-transfected in MCF-7 cells with mimic and antisense of let-7a. 24 h of post-transfection cells were harvested and lysed using glycerol containing lysis buffer, and then lysate was mixed with buffer containing luciferin and luminescence was measured using Promega Glo Max. The expression was normalized with protein concentration.
ND4 mRNA stability assay
The effect of let-7a on mtDNA encoded transcript stability was evaluated by treating cells with mitochondrial transcriptional inhibitor EtBr at a concentration of 50 ng/ml. Cells were treated with EtBr for 24 h, followed by transfection of let-7a mimic for another 24 h. Cells were than harvested for analyzing the expression of ND4 using reverse transcriptase PCR.
Immunoblotting
Further, to determine the half-life of mtDNA encoded ND4, cells were treated with EtBr and transfected with a mimic of let-7a for 12, 24, 36, and 48 h. Cells were harvested for RNA isolation and processed for RT-PCR. The reaction was initiated at 94 °C for denaturation for 10 min followed by annealing and extension at 62 °C (30 s) and 72 °C (30 s), respectively, for 35 cycles.
MtDNA copy number analysis
Briefly, DNA was isolated from let-7a transfected (mimic/antisense), and DOX treated MCF-7 and MDA-MB-231 cells, using phenol–chloroform method. Approximately 50 ng total DNA was used for quantitative analysis of mtDNA level by qPCR using SYBR Green master mix. The relative copy number of mtDNA was determined using mitochondrial-specific primer for ND4 and nuclear specific β-Actin. Quantitative analysis was carried out using the following reaction conditions; the pre-amplification step was carried out at 95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, annealing was performed at 58 °C for 30 s and final extension was carried out at 72 °C for 30 s. After obtaining the Ct values, the mtDNA copy number was calculated using the following formula: Copies of mtDNA = 2 * 2^Ct [41].
Measurement of cellular ATP
Total ATP level was measured in MDA-MB-231 and MCF-7 cells, after 24 h of transfection with let-7a mimic/antisense (20 nM) and treatment with DOX. Cells were harvested and an adequate amount of lysis buffer (Tris–Cl pH 7.8–25 mM, EDTA 2 mM, glycerol 10%, Triton X 100-1%) were added then samples were boiled for 5 min at 95 °C, and protein concentration was determined using Bradford reagent. All the components used in ATP assay are procured from Invitrogen. The mixture containing lysate and reaction buffer were incubated on ice for 10 min in the dark and then luminescence was recorded using Glo max luminometer (Promega) [42].
Estimation of the number of mitochondria
Mitotracker red (Invitogen™, M22426) was used to determine the number of mitochondria present in DOX treated and let-7a transfected (mimic/antisense) MCF-7 cells. Briefly, cells were seeded on a coverslip and treated as described. After 24 h of treatment, media was removed and cells were washed with pre-warmed culture media and then incubated with media containing 300 nM of mitotracker red (Molecular Probes, Thermo) for 40 min in a CO2 incubator at 37 °C. After incubation, mitotracker media was removed and cells were washed with pre-warmed media, and cells were fixed with 3.7% paraformaldehyde prepared in complete growth media for 15 min at 37 °C and then washed three times with 1× PBS. Cells were permeabilized using permeabilization buffer (0.2% Triton X-100) for 15 min at 37 °C and then cells were again washed with 1× PBS. Finally, cells were stained with DAPI diluted in PBS for 20 min and then washed three times with 1×PBS. Using Antifade mounting media (Sigma), coverslips were mounted on clean microscopic glass slides and images were captured using Olympus Fluoview FV1000 [43, 44]. The same analysis was also performed using flow cytometry.
Measurement of ROS levels
H2DCFDA fluorescent probe was used to determine intracellular ROS. ROS levels were measured in let-7a transfected (20 nM mimic/antisense) and DOX treated (50 nM) MCF-7 cells after incubating with 5 µM H2DCFDA (Invitrogen, Molecular Probe) for 30 min in the dark. After incubation, cells were washed with 1× PBS and collected for flow cytometer analysis. For the analysis of each sample, 50,000 events were captured, and data were analyzed [37].
Protein extraction and western blot analysis
MCF-7cells were treated and transfected with the above-mentioned protocol and after 24 h of treatment and transfection, cells were harvested and washed with 1× PBS. Protein lysates were prepared using RIPA lysis buffer and quantified by using Bradford reagent. About 100 µg of protein sample were subjected to SDS-PAGE on 10% and 12% gel, which were then transferred onto the nitrocellulose membrane. The membranes were probed for overnight at 4 °C with primary antibodies PGC-1α (1:1000, Sigma), TOMM 22 (1:3000, Sigma), MT-ND4 (1:800, Sigma), TFAM (1:1000, Sigma), and β-Actin (1:3000, Sigma). After overnight incubation, membranes were subsequently washed three times with 1× PBST and incubated with HRP-conjugated secondary antibodies (1:10,000) (Invitrogen) for 2 h at room temperature. After completion of secondary antibody incubation, blots were rewashed and analyzed using ECL, and images were captured using Image 2.0 software from Biorad [37]. β-Actin was taken as a housekeeping gene.
Annexin V/propidium iodide analysis
An apoptotic profile of MCF-7 cells determined after 24 h of transfection with mimic/antisense of let-7a and treatment with dox using flow cytometer. After completion of subsequent treatment time, cells were harvested and washed with 1× PBS followed by the addition of 5 µl Propidium iodide dissolved in 1× annexin binding buffer which was then resuspended in 80 µl of 1× annexin binding buffer. After that 5 µl of FITC Annexin V and 1 µl of PI (propidium iodide) was added to each sample and were incubated for 15 min at room temperature. After the incubation period, stained cells were processed and approximately, 50,000 events were captured using flow cytometer. Reagents used in this assay were purchased from Invitrogen™.
Measurement of oxygen concentration
Measurement of mitochondrial respiration is essential to gain insight into mitochondria respiration capacity of complexes (I–IV) and metabolism and can be accomplished by measuring oxygen concentration using a high-resolution Oxygraph. To measure the respiration capacity of different complexes, different substrates and inhibitors can be employed. Respiration of permeabilized MDA-MB-231 and MCF-7 cells was investigated by substrate-uncoupler-inhibitor titrations (SUIT) protocol with slight modifications [45]. Approximately 1 * 106 cells were added in the Oxygraph chamber containing serum-free DMEM media. 16 µl (8 µM) of digitonin was injected into the Oxygraph chamber containing cell suspension for permeabilization and respiration was recorded for 10 min. Malate and succinate at a concentration of (5 mM) and (10 mM) respectively were added in the presence of Complex I (CI) inhibitor rotenone to determine CI or CII linked respiration. ADP was added at 2.5 mM to obtain OXPHOS capacity. After adding substrates and inhibitors, respiration was recorded for 10 min each until the signal become stable.
Assessment of glycolysis in MDA-MB-231 and MCF-7 cells
Cayman’s MitoCheck Complex I Activity assay kit (Item No. 700930) was used to detect the difference in Complex I activity of MDA-MB-231 and MCF-7 cells. Cells were seeded and transfected with 20 nM mimic and antisense of let-7a for 24 h and then cells were harvested and processed according to the manufacturer’s protocol.
Assessment of glycolysis in MDA-MB-231 and MCF-7 cells
Approximately, 7000 cells per well were seeded in 96 well cell culture plates and then allowed the cells to grow overnight in CO2 at 37°. After incubation, cells were transfected with 20 nM mimic and antisense of let-7a for 24 h. After completion of time point, samples were processed as prescribed by manufactures instruction (Cayman Chemical, Glycolysis Cell-Based Assay Kit, Item No. 600450). At last absorbance was recorded at 490 nm using a microplate reader (Synergy™, Multimode Microplate Reader, BioTek) and concentration of lactate was measured using standard plotted for l-Lactate (mM).
Oil Red O staining in cultured MCF-7 cells
Quantitative analysis of deposition of lipids was determined by Oil Red O staining. Briefly, cells were seeded in 24 well plate and transfected with 20 nM mimic/antisense of let-7a. After 24 h of transfection, media was discarded and fixed with 10% formalin for 5 min. After fixation, cells were subsequently washed with 60% isopropanol and then stained with a stock solution of Oil Red O (containing 3parts of Oil Red O and 2 parts of water) for 10 min. Cells were then washed with water and again incubated with 100% isopropanol for 10 min and OD was obtained at 518 nm and desired images were taken [46].
Statistical analysis
MS Excel and Graphpad Prism were used to analyze the data and to plot the graphs. Each experiment was performed three times. The results are presented as mean ± SD. A two-tailed t-test and two-way ANOVA were used for testing the level of significance.
