Clinical specimens
From 2013, 37 patients diagnosed with prostate adenocarcinoma underwent radical prostatectomy at the Department of Urology, Zhejiang Cancer Hospital. Lymph node metastasis was determined according to pathological analysis of biopsies obtained by lymphadenectomy. For each specimen pair, an experienced pathologist discriminated the cancerous nodule from the adjacent non-tumor tissue.
Cell culture and transient transfection
Human prostate cancer cell lines PC3, Du145, and 22Rv-1, and the human prostate epithelial cell line RWPE were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The human normal kidney cell line HEK293T was a kind gift by Dr Zhao An from the Central Laboratory of Zhejiang Cancer Hospital. All cells were maintained in RPMI-1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA).
After transfection of miRNA and/or siRNA, cells were harvested, counted, and seeded into six-well plates (Costar, Corning, CA, USA). Lipofectamine 2000™ reagent (Invitrogen) was employed to transfect siRNA (GenePharma, Shanghai, China) miR-124 mimics (RiboBio, Guangzhou, China), and miR-124 inhibitors (RiboBio, Guangzhou, China) into cells at 50, 100, and 200 nM, respectively. For mimics, NC RNA (the negative control), inhibitors, and siRNA, the duration of transfection was 48 h. For co-transfection with plasmids, transfection was performed for 24 h. The sequences were as follows (5′–3′): NC RNA, ACUACUGAGUGACAGUAGA; has-miR-124 [Pubmed Nucleotide: accession number: MI0000443], GGCAUUCACCUCGUGCCUUA; has-miR-124 inhibitors, UAAGGCACGCGGUGAAUGCC; talin 1 siRNA, GAAGCCUCUUCUAUUUAAUGCAGAC.
3′-UTR vector construction for luciferase reporter assays
The talin 1 3’-UTR fragment containing the seed sequence was amplified by PCR using cDNA from RWPE cells and the following primers: forward, 5′-CGAGCTCCAGTCCCGCAGTACAT-3′; reverse, 5′-GCCGCGGTGGGGGAAGATAGTAT-3′. The amplified fragment was cloned downstream of the luciferase-coding sequence in a pmir-GLO expression vector (Promega, Wisconsin, USA) at the sites of Sal I and Sac I endonucleases (Takara, Dalian, China). The vector containing the seed sequence was called pGL-TLN1. A control vector containing a mutated sequence generated by a quickChange™ Site-directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) was called pGL-mut. HEK293T cells were transfected with 100 ng pGL-TLN1 + NC RNA, pGL-TLN1 + miR-124, pGL-mut + miR-124, and pGL-mut + NC RNA. After 24 h, the cells were harvested and subjected to a Dual Luciferase Reporter Assay kit (Promega, Wisconsin, USA). The lysate was then analyzed by a bioluminescence detection system (Berthold Technologies, Bad Wildbad, Germany) to determine the relative light units.
Transwell migration and invasion assays
After transfection, 1 × 105 cells suspended in 200 μL RPMI-1640 medium without FBS were added to the upper chamber of a Millicel transwell chamber (8-μm pore size, Millipore, Billerica, USA). For invasion assays, the filter membrane was coated with 30 μL matrigel (BD Biosciences, Franklin Lakes, USA) diluted in RPMI-1640 medium at a ratio of 1:8. A total of 600 μL medium containing 10% FBS was added to the lower chamber. After incubation for 24 h, the migrated/invaded cells were fixed with methanol, stained with 1% crystal violet, and counted under an inverted microscope.
Attachment assay
After transfection, cells were collected, counted, and seeded in 24-well plates (1 × 105 cells per well) coated with fibronectin (BD Biosciences, Franklin Lakes, USA). After 1 h of incubation, the unattached cells were removed by washing with PBS three times. The remaining cells were fixed with methanol, stained with 1% crystal violet, and counted under an inverted microscope.
Real-time RT-PCR
To determine the relative expression levels of miR-124 and talin 1, total RNA and small RNA were extracted from cells using RNAiso Plus reagent and RNAiso for Small RNA reagent (Takara), respectively. cDNA of miRNA was then synthesized using a One Step PrimeScript® miRNA cDNA Synthesis Kit. Total cDNA was synthesized using a PrimeScript® RT reagent Kit (Takara). Subsequently, real-time RT-PCR was performed with SYBR® Premix Ex Taq™ II (Takara) on an ABI 7500 Real-time PCR System (Applied Biosystems, Foster City, CA, USA). U6 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes were used as endogenous controls. The primers were as follows: miR-124, 5′-TAAGGCACGCGGTGAATGCC-3′; U6, 5′-TGCGGGTGCTCGCTTCGGCAGC-3′; talin 1 forward, 5′-TGAGTCAGTGTGCCAAGAA-3′ and reverse, 5′-TAGATTCTGTACCACACT-3′; GAPDH forward, 5′-AAGGTGAAGGTCGGAGTCA-3′ and reverse, 5′-GAAGATGGTGATGGGATTT-3’. The relative expression levels of target genes were quantified by normalization to endogenous U6 or GAPDH expression levels, which was calculated as 2-ΔΔC(t).
Immunoprecipitation
Immunoprecipitation was performed with a Pierce Classic IP Kit (Thermo Scientific, Austin, TX, USA). DU-145 cells as well as NC RNA and miR-124 transfectants were lysed in RIPA buffer (Beyotime Biotech, Hangzhou, China). Total protein was extracted and quantified. Protein samples (100 μg) were incubated overnight at 4°C with the antibody. After incubation of the lysates with Protein G Plus/Protein A agarose beads (30 μL) for 1 h at 4°C, the agarose was centrifuged in PBS and then subjected to SDS-polyacrylamide gel electrophoresis (PAGE). Finally, the proteins were transferred to 0.22-μm nitrocellulose membranes (Abcam, Cambridge, MA, USA).
Western blot analysis
Total proteins in cells were extracted using RIPA buffer, quantified using a Pierce BCA Protein Assay Kit (Thermo Scientific, Austin, TX, USA), separated on 6% SDS-PAGE gels, and then transferred onto nitrocellulose membranes. The membranes were blocked in 5% dry skim milk for 1 h at room temperature, followed by incubation with each primary antibody overnight at 4°C. Rabbit or mouse monoclonal antibodies against talin 1 were obtained from Abcam. Antibodies against FAK, Akt, phospho-FAK (Y397), phospho-Akt (S473), MAPK, and phospho-MAPK were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibodies against integrin β3, Src, MMP2, MMP9, E-cadherin, and GAPDH were from Epitomics (Burlingame, CA, USA). The membranes were then incubated with secondary antibodies and visualized using an EZ-ECL kit HRP (BioInd, Kibbutz Beit Haemek, Israel).
Over-expression vector construction and rescue experiment
To investigate the effect of talin 1 over-expression in cells, we designed a pair of primers (forward: 5′-CCGGATCCATGGTTGCACTTTCACT-3′; reverse: 5′-CCGAATTCTAGAAGAGGCTTCTTT-3′) to amplify the coding sequence of the talin 1 gene using cDNA from RWPE cells by PCR. The amplified sequence was then cloned into a pCDNA3.1+ expression vector (Invitrogen) using BamHI and EcoRI endonucleases (Takara). The vector containing the target sequence was called p-TLN1. A control vector with a mutated sequence generated by the quickChange™ Site-Directed Mutagenesis kit was called p-CON. To directly examine the interaction between miR-124 and talin 1 in prostate cancer cells, we performed a rescue experiment. The over-expression vector was transfected with Lipofectamine 2000™ reagent at 1 μg per well. The cells were co-transfected with p-TLN1 + NC RNA, p-TLN1 + miR-124, p-CON + miR-124, and p-CON + NC RNA for 24 h and then harvested for western blot and functional analyses.
Statistical analysis
The Student’s t-test was performed using SPSS version 17.0 software for statistical analysis. A p-value of less than 0.05 was considered statistically significant. Data represent the means ± standard deviation (standard deviation) of three independent measurements. The correlation analysis was performed and charted by the software Prism Graphpad version 5.0c.
